|
| Status |
Public on Jan 25, 2021 |
| Title |
testis transcriptome experimental mouse 2 |
| Sample type |
SRA |
| |
|
| Source name |
testis
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL/6J
mutation: Homozygous Ret (V805A)
treatment: injected for 9 days with vehicle [saline:cremophor:ethanol (7:2:0.9)] containing 1NaPP1-HCl at 4/465 mg/ml, 10 microliters per gram body weight
age: ~120 days
|
| Treatment protocol |
Control mice were injected with 10 microliters per gram body weight with saline:cremophor:ethanol (7:2:0.9). Experimental mice were injected with vehicle in which was dissolved 1NaPP1-HCl at 4/465 mg/ml vehicle. Injections continued daily for 9 days total. Mice were allowed to recover for 5 days prior to testis dissection (experiment day 14).
|
| Growth protocol |
standard mouse facility
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted with the Qiagen RNAeasy Mini kit.
Diretional RNA-seq libraries were prepared from 500ng total RNA using the NEBNext Directional Ultra RNA Library Prep Kit for Illumina (New England Biolabs), with initial polyA+ isolation.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
gene_exp.diff: E_1
genes.read_group_tracking: E_1
|
| Data processing |
Illumina pipeline software v1.8 was used for base calling.
cutadapt v1.8 (-m 20 -q 20 -a AGATCGGAAGAGCACACGTCTGAACTCCAGTC --match-read-wildcards) was used to trim and filter reads.
tophat v2.0.13 (--no-novel-juncs --library-type fr-firststrand) was used to map reads to the mouse mm10 reference genome+transcriptome (UCSC).
cuffquant (--library-type fr-firststrand) was used to quantify transcripts based on the mouse mm10 reference genome+transcriptome (UCSC).
cuffdiff v2.2.1 was used to call differentially expressed genes based on the mouse mm10 reference genome+transcriptome (UCSC).
Genome_build: Mouse mm10 (UCSC)
Supplementary_files_format_and_content: Tab delimited text files are standard cuffdiff2 output files for gene-level analysis, including counts, FPKM values, and q-values for differential expression testing (corrected for multiple hypothesis testing). The 'gene_exp.diff' file contains average FPKM values for each pair of replicates as well as results for statistical testing for differential expression. The 'genes.read_group_tracking' file contains raw mapped read counts and FPKM values for individual samples.
|
| |
|
| Submission date |
Mar 06, 2018 |
| Last update date |
Jan 25, 2021 |
| Contact name |
Jennifer K Grenier |
| Organization name |
Cornell University
|
| Department |
Biomedical Sciences
|
| Lab |
Biotechnology Building rm 333
|
| Street address |
526 Campus Rd
|
| City |
Ithaca |
| State/province |
NY |
| ZIP/Postal code |
14853 |
| Country |
USA |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE111487 |
Effect of 9 days of inhibited GDNF signaling on the transcriptome of the mouse testis |
|
| Relations |
| BioSample |
SAMN08640202 |
| SRA |
SRX3768780 |
