GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2862998

Query DataSets for GSM2862998

Status

Public on Mar 14, 2019

Title

ST486_DMSO_8hr_1

Sample type

SRA

Source name

ST486

Organism

Homo sapiens

Characteristics

cell type: B lymphocyte
inducible expression system: none
timepoint: 8 hour
cell line: ST486
treatment: 0.4% DMSO

Treatment protocol

Cells were treated with either 0.4% DMSO, 1 µM KI-MS2-008, 10 µM KI-MS2-008 or 0.1 µg/mL doxycycline, followed by brief shaking to mix. Cells were treated for 45 minutes or 8 hours.

Growth protocol

Cells were plated at 3 million cells in 3 mL media per well in 6-well plates.

Extracted molecule

total RNA

Extraction protocol

1.5 million cells were washed with 1 mL cold PBS, followed by extraction of RNA using Aurum™ Total RNA Mini Kit (BioRad 732-6820)
RNA samples were quantified and quality assessed using an Advanced Analytical Fragment Analyzer. 20 ng of totalRNA was used for library preparation with ERCC Spike-in control Mix A (Ambion 10-6 final dilution). All steps were performed on a Tecan EVO150. 3’DGE-custom primers 3V6NEXT-bmc#1-24 were added to a final concentration of 1.2 µM. (5'-/5Biosg/ACACTCTTTCCCTACACGACGCTCTTCCGATCT[BC6]N10T30VN-3' where 5Biosg = 5’ biotin, [BC6] = 6bp barcode specific to each sample/well, N10 = Unique Molecular Identifiers, Integrated DNA technologies). After addition of the oligonucleotides, samples were denatured at 72 °C for 2 minutes followed by addition of SMARTScribe RT per manufacturer’s recommendations with Template-Switching oligo5V6NEXT (12 µM, [5V6NEXT : 5’-iCiGiCACACTCTTTCCCTACACGACGCrGrGrG-3’ where iC: iso-dC, iG: iso-dG, rG: RNA G ]) and incubation at 42 °C for 90 minutes followed by inactivation at 72 °C for 10 minutes. Following the template switching reaction, cDNA from 24 wells containing unique well identifiers were pooled together and cleaned using RNA Ampure beads at 1.0X. cDNA was eluted with 90 µl of water followed by digestion with Exonuclease I at 37 °C for 45 minutes, inactivation at 80 °C for 20 minutes. Single stranded cDNA was then cleaned using RNA Ampure beads at 1.0X and eluted in 50 µl of water. Second strand synthesis and PCR amplification was done using the Advantage 2 Polymerase Mix (Clontech) and the SINGV6 primer (10 pmol, Integrated DNA Technologies 5’-/5Biosg/ACACTCTTTCCCTACACGACGC-3’ ). 12 cycles of PCR were performed followed by clean up using regular SPRI beads at 1.0X, and was eluted with 20 µl of EB. Successful amplification of cDNA was confirmed using the Fragment Analyzer. Illumina libraries were then produced using standard Nextera tagmentation substituting P5NEXTPT5-bmc primer (25 μM, Integrated DNA Technologies, (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG*A*T*C*T*-3’ where * = phosphorothioate bonds. ) in place of the normal N500 primer. Final libraries were cleaned using SPRI beads at 0.8X and quantified using the Fragment Analyzer and qPCR before being loaded for paired-end sequencing using the Illumina NextSeq500.
3' Digital Gene Expression (adapted from Soumillon et al. bioRxiv March 5, 2014 doi: https://doi.org/10.1101/003236 ).

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina NextSeq 500

Description

counts_raw_cpms.txt
Merged fastq files contain genomic reads with barcode informations concatenated with read IDs; collapsed reads contain single exemplars of reads, collapsed by UMI and reads sequence, which were used for downstream analyses.

Data processing

Post-sequencing, quality-control on each of the libraries was performed to assess coverage depth, enrichment for messenger RNA (exon/intron and exon/intergenic density ratios), fraction of rRNA reads and number of detected genes using bespoke scripts. Reads bearing the same Unique Molecular Identifier (UID) and the same sequence were collapsed into unique exemplar for downstream processing. Sequences were aligned against the human genome hg19 and ERCC reference sequences separately using bwa.
Gene expression was estimated based on reads mapping near the 3' end of transcripts using ESAT (Derr A. et al. End Sequence Analysis Toolkit (ESAT) expands the extractable information from single-cell RNA-seq data. Genome Res. 2016 Oct;26(10):1397-1410. Epub 2016 Jul 28.) based on the hg19 Refseq annotation.
Results were summarized as counts per million mapped reads (CPMs), merged across samples, log-transformed and subjected to hierarchical clustering and visualization. For ERCC quantification, bam files from bwa were sorted and indexed with samtools (Li H. et al. 1000 Genome Project Data Processing Subgroup. The Sequence Alignment/Map format and SAMtools. Bioinformatics. 2009 Aug 15;25(16):2078-9. doi: 10.1093/bioinformatics/btp352. Epub 2009 Jun 8.) and counts were retrieved from the indices using idxstats.
Genome_build: hg19
Supplementary_files_format_and_content: raw counts and Counts per M mapped reads (CPMs) are reported for each annotated gene in each sample (tab-delimited file).

Submission date

Nov 21, 2017

Last update date

May 15, 2019

Contact name

Andrew Chen

E-mail(s)

achen5@mit.edu

Organization name

Massachusetts Institute of Technology

Department

Biological Engineering