 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Sep 13, 2018 |
| Title |
7012_PP_RRBS |
| Sample type |
SRA |
| |
|
| Source name |
hepatocytes
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: liver
hepatic zone: periportal (PP)
isolation: laser capture microdissection
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
RRBS: The frozen tissue was cut in 20 µm slices, mounted on precooled glass-slides and dried at room temperature for 30 minutes. In sum, an area of 200.000 µm2 per sample was microdissected using a ZEISS PALM MicroBeam LCM in Auto-LPC mode. Tissue pieces subjected for RRBS were frozen and maintained at -80° C. RNA-seq: The frozen tissue was cut in 20 µm slices and mounted on precooled glass-slides. Immediately after mounting, the tissue was fixed by incubation in 70% EtOH for 2 min and stained by incubation in a cresyl violet/50% EtOH solution for 30 sec with two short subsequent wash steps in 70% EtOH, followed by a 2 min air-drying step. All steps were performed on ice. In sum, an area of 500.000 µm2, from of 5-10 periportal fields and intermediate zones or hepatozytes surrounding 15-20 central veins per sample, were microdissected using a ZEISS PALM MicroBeam LCM in Auto-LPC mode. Tissue pieces subjected for RRBS were frozen and maintained at -80° C. Samples subjected for RNA-Seq were immediately processed.
RRBS: Cell lysis of microdissected material was done directly in the caps of the capturing tubes by treatment with 8 µl lysis buffer (10 mM Tris-HCl, 5 mM EDTA) and 2 µl Proteinase K (1 mg/ml, NEB) at 55 °C for 3 hours. For proteinase inactivation 0.5 µl Pefabloc (21 mM, Sigma) was added for 1 hour at room temperature. Restriction was performed using the methylation insensitive enzymes HaeIII (25 U, NEB) and AluI (5 U, NEB) supplemented with 1.5 µl CutSmart buffer (10 X, NEB), 1 µl MgAce (5 mM) and 1 µl yeast tRNA (100 ng) at 37 °C for 18 hours. Enzymes were inactivated at 80 °C for 20 min. A-Tailing was achieved with 1 µl Klenow Fragment (3′ → 5′ exo−, 5 U/µl, NEB) and 1 µl dATP (10 mM, NEB) at 37 °C for 30 min followed by enzyme inactivation at 75 °C for 20 min. Methylated Illumina TruSeq sequencing adapters (adapter 1: ACACTCTTTCCCTACACGACGCTCT TCCGATCT, adapter 2: GATCGGAA GAGCACACGTCTGAACTCCAGTCAC) were ligated using 1 µl pre-annealed adapters (100 µM), 0.5 µl T4 Ligase (2,000,000 U/µl, NEB) and 2 µl ATP (10 mM, NEB) at 16 °C for 22 hours. Subsequent bisulfite conversion was performed using the EZ DNA Methylation Gold Kit (Zymo). Adapter ligated fragments were amplified by PCR using 0.5 µl each of indexed TruSeq primers (10 µM, Primer I5: AATGATACGGCGACCACCGAGATCTACAC[i5]ACACTCTTTC CCTACACGACGCTCTTCCGAT,Primer I7: GATCGGAAGAGCACACGTCTGAACTC CAGTCAC[i7]ATCTCGTATGCCGTCTTCTGCTTG), 3 µl PCR Buffer (10 X, Qiagen), 1.2 µl MgCl2 (25 mM), 2.4 µl dNTPs (10 mM) and 0.5 µl Hot Start Taq (5 U / µl, Qiagen) in a 30 µl reaction with 95 °C for 15 min, 22 cycles of 95 °C for 30 sec, 60 °C for 30 sec, 72 °C for 1 min and final elongation at 72 °C for 7 min. After purification with 0.8 X Ampure XP Beads (Beckman Coulter) libraries were sequenced on a HiSeq2500 (Illumina) using TruSeq SBS Kit v3 – HS chemistry in a single read run with 90 bp read length. RNA-seq: After microdissection, RNA was isolated using the RNeasy Micro Kit (Qiagen, Hilden, Germany). Concentration and RNA Quality was obtained by using an Agilent BioAnalyzer (Agilent, Santa Clara, CA). The typical yield was between 4.5 ng and a RIN between 8 and 9. The RNA was reverse transcribed and amplified with the SMARTer Universal Low Input RNA Kit for Sequencing (Takara/Clontech) and 1 ng of RNA. Libraries for next generation sequencing were constructed with the Nextera DNA Library Prep Kit (Illumina) and sequenced on a HiSeq2500 Sequencer.
|
| |
|
| Library strategy |
Bisulfite-Seq |
| Library source |
genomic |
| Library selection |
Reduced Representation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
HaeIII / AluI restriction
|
| Data processing |
RRBS: Reads were trimmed with Trim Galore! (v0.4.2, http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) for adapter contamination and 3' ends with base quality below 20 in RRBS mode.
RRBS: The reads were then aligned to the 1000 genomes version of the human GRCh37 reference (PMID: 26432245) with the BWA (v0.6.2) (PMID: 19451168) wrapper methylCtools (v0.9.2) (PMID: 24847876).
RRBS: Samtools (v1.3) (PMID: 19505943) and Picard tools (v1.115) (http://broadinstitute.github.io/picard/) were utilized for converting, merging and indexing of alignment files.
RRBS: Bis-SNP was used for SNP (dbSNP, v138, http://www.ncbi.nlm.nih.gov/SNP) aware realignment, quality recalibration and methylation calls.
RNA-seq: Reads were trimmed with Trim Galore! (v0.4.2) http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/) for adapter contamination and 3' ends with base quality below 20.
RNA-seq: The reads were then aligned to the 1000 genomes version of the human GRCh37 reference (PMID: 26432245) with the STAR (v2.5.2a) (PMID: 23104886) and the per-sample 2-pass mapping strategy processing all reads in both passes as described in the documentation.
RNA-seq: Read counts were summarized to Gencode gene models (v19) (PMID: 22955987) with featureCounts (v1.5.0-p3) (PMID: 24227677) counting primary alignments only.
Genomic tracks (bigwig and bed) were generated using bedtools (PMID: 20110278) and UCSC tools (PMID:22908213).
Genome_build: hg19
Supplementary_files_format_and_content: RRBS: bed files contain genomic coordinates, methylation values and coverage of all covered CpGs of a sample; bigwig files (.CG.bw) contain methylation values and bigwig files (coverage_ct.bw) coverage information. RNA-seq: bigwig files contain coverage information.
|
| |
|
| Submission date |
Oct 18, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Alexander Herrmann |
| Organization name |
Technical University Dresden, University Hospital Carl Gustav Carus
|
| Department |
Clinic of Internal Medicine I
|
| Lab |
MK1L18
|
| Street address |
Fetscherstraße 74
|
| City |
Dresden |
| ZIP/Postal code |
01307 |
| Country |
Germany |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE105127 |
Epigenomic analysis of micro-dissected human liver reveals principles of zonated morphogenic and metabolic control |
|
| Relations |
| BioSample |
SAMN07810653 |
| SRA |
SRX3298664 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2819662_PP_7012_337.MCSv3.20170201.hs37.cpg.filtered.CG.bed.gz |
119.3 Mb |
(ftp)(http) |
BED |
| GSM2819662_PP_7012_337.MCSv3.20170201.hs37.cpg.filtered.CG.bw |
94.3 Mb |
(ftp)(http) |
BW |
| GSM2819662_PP_7012_337.MCSv3.20170201.hs37.cpg.filtered.CG.ct_coverage.bw |
93.6 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
