|
| Status |
Public on Jun 14, 2019 |
| Title |
24hr MCAO ipsilateral miRNAseq, replicate 1 |
| Sample type |
SRA |
| |
|
| Source name |
anesthesized and MCAO surgery performed
|
| Organism |
Mus musculus |
| Characteristics |
strain: C57BL6
tissue: cortex - ipsilateral hemisphere
age: 7-8 weeks
biological replicate: replicate 1
reperfusion time point: 24hr
library type: small RNAseq
|
| Treatment protocol |
Sham or MCAO surgery, cortical tissue dissected
|
| Growth protocol |
standard animal husbandry and breeding of wildtype C57BL6
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was extracted using Trizol reagent, precipitated with ethanol, DNase-treated, phenol-chloroform extracted, precipitated once more with ethanol and yields determined by absorption spectroscopy using a NanoDrop (NanoDrop Products).
miRNAseq libraries were generated following Illumina TruSeq small RNA protocol, PCR amplified 140-160bp fragments (15-35bp inserts + adaptors) isolated and purified for 69bp single-end sequencing on MiSeq (Illumina).
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina MiSeq |
| |
|
| Description |
24hr stroke-ipsi, replicate 1
I1_24hr
|
| Data processing |
Clipped adapter sequence (TGGAATTCTCGGGTGCCAAGGAACTCC) from demultiplexed reads, aligned to mature mouse miRNA database using novoalign (Novocraft Technologies) applying iterative 3'trimming and retaining only single-hit reads.
Counts of all mature mouse miRNAs generated, difference analysis of gene expression changes was carried out in R (www.r-project.org; [Ihaka and Gentleman, 1996]) using Bioconductor (Gentleman et al., 2004) and the package edgeR (Robinson and Oshlack, 2010) applying generalized linear model methods to account for biological variation across replicates (McCarthy et al., 2012)
Genome_build: mature mouse miRNAs (miRBase)
Supplementary_files_format_and_content: matrix of counts for all mature mouse miRNAs, for each replicate of all conditions, sham(S), contralateral(C), ipsilateral(I), and time points (3-24hr). Input for difference analysis using EdgeR
|
| |
|
| Submission date |
Sep 20, 2017 |
| Last update date |
Jun 14, 2019 |
| Contact name |
Mariko Kobayashi |
| E-mail(s) |
mkobayashi@rockefeller.edu
|
| Organization name |
Rockefeller University
|
| Department |
Molecular Neuro-Oncology
|
| Lab |
Robert B. Darnell
|
| Street address |
1230 York Avenue
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL16417 |
| Series (2) |
| GSE104037 |
AGO CLIP reveals an activated network for acute regulation of brain glutamate homeostasis in ischemic stroke [dataset 3] |
| GSE104053 |
AGO CLIP reveals an activated network for acute regulation of brain glutamate homeostasis in ischemic stroke |
|
| Relations |
| BioSample |
SAMN07674627 |
| SRA |
SRX3200404 |
