GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM2705416

Query DataSets for GSM2705416

Status

Public on Jul 18, 2017

Title

V51

Sample type

SRA

Source name

dorsal lateral prefrontal cortex (Brodmann Area 9)

Organism

Homo sapiens

Characteristics

diagnosis: DSM-IV major depressive disorder suicides (MDD-S)
age (yrs): 52
Sex: Male
rin: 8.2
pmi: 16
brain ph: 6.7
tissue: dorsal lateral prefrontal cortex (Brodmann Area 9)

Extracted molecule

total RNA

Extraction protocol

RNA was extracted from dorsal prefrontal cortex (BA9) as previously described (Sibille E, Arango V, Galfalvy HC, Pavlidis P, Erraji-Benchekroun L, Ellis SP, et al. Gene expression profiling of depression and suicide in human prefrontal cortex. Neuropsychopharmacology. 2004;29(2):351–61) and according to the guidelines recommended by the NIH Roadmap Epigenomics Mapping Consortium (REMC). We used the Ambion’s mirVana miRNA isolation kit (#. AM1560, Life Technologies, Carlsbad, CA, USA) to isolate total RNA from postmortem brain tissue (Brodmann Area 9).
The coding RNA library was generated using the TruSeq Stranded Total RNA Sample Prep kit (Illumina, San Diego, CA, USA) which includes rRNA depletion and chemical fragmentation. Paired-end, strand specific sequencing for total RNA was performed on Illumina HiSeq 2500 with 100 bp read lengths.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 2500

Description

Sample_M19

Data processing

For each clinical sample, raw RNA-seq reads were aligned and mapped to the Ensembl GRCh37 human reference genome and assembled using Tophat v2.0.9 resulting in BAM files for each of 59 samples. Between 17,000,000 and 57,000,000 reads were obtained for each sample, and ~75–90% of reads were successfully mapped to the genome for each sample. Of these reads, ~10–15% aligned to multiple genomic loci.
For each BAM file resulting from Tophat2, read counts per gene were summarized using the ‘summarizeOverlaps’ (union mode) function in the GenomicAlignments R library and a transcript database derived from the GRCh37 human genome assembly.
Read counts per gene were normalized and written to csv file using the 'counts' function in DeSeq2 v1.6.3
For micro RNA samples, sequence adaptors were first trimmed i.e. using the command "cutadapt -b GATCGTCGGACTGTAGAACTCTGAAC -b TGGAATTCTCGGGTGCCAAGG", the resulting FastQ files were then converted to FASTA format and processed according to the Small RNA Analysis pipeline in CLC Genomics Workbench version 7.5 (http://www.clcbio.com/products/clc-genomics-workbench/ ) using default settings (i.e. mature length variants were allowed 2 additional or missing upstream and downstream base-pairs and 2 mismatched base-pairs, and alignment was strand-specific). Unique reads were extracted and counted and subsequently merged and annotated according to known miRNA species included in miRBase Release 21. Total counts for each miRNA (1,353 unique annotations with positive counts for one or more samples) were divided by the total library size to arrive at an expression value for each sample.
Genome_build: GRCh37 human genome assembly
Supplementary_files_format_and_content: counts_output.csv: Rows are gene ensemble IDs, columns are sample IDs

Submission date

Jul 17, 2017

Last update date

May 15, 2019

Contact name

Spiro Pantazatos

E-mail(s)

spp2101@columbia.edu

Organization name

Columbia University

Department

Psychiatry