|
| Status |
Public on Sep 23, 2017 |
| Title |
43688 PEA SSIII s4U-IAA Rep 2 |
| Sample type |
SRA |
| |
|
| Source name |
PEA SSIII s4U-IAA
|
| Organism |
synthetic construct |
| Characteristics |
molecule subtype: synthetic RNA control oligo containing dme-let7 sequence with s4U at position 9 flanked by 3' and 5' adapter sequences (5L-let-7-s4U-p9-3L)
|
| Treatment protocol |
template RNA oligonucleotides (5L-let-7-3L or 5L-let-7-s4Up9-3L; Dharmacon) were deprotected according to the instructions of the manufacturer and purified by denaturing polyacrylamide gel-elution.
|
| Growth protocol |
n.a.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
synthetic RNA control oligo were subjected to IAA-alkylation or control reactions, preciptiated and reverse transcribed; full length cDNA was gel purified, PCR amplified and sequenced
PCR amplification of full length cDNA products
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
synthetic RNA control oligo was subjected -IAA control reaction and preciptiated; reverse transcription was performed with SSIII, full length cDNA was gel purified, PCR amplified and sequenced
|
| Data processing |
Basecalls performed using RTA V1.18.64.0
Cutadapt v1.7.1 was used to trim adapters (allowing for default 10% mismatch in adapter sequence) and sequences of 21nt length were filtered.
Adapter trimmed sequences were aligned to mature dme-let-7 sequence (TGAGGTAGTAGGTTGTATAGT) using bowtie v0.12.9 allowing for 3 mismatches and converted to bam using samtools v0.1.18.
“N” containing sequences were filtered from alignment. Remaining alignments were converted to pileup format. Finally, fraction of each mutation per position were extracted from pileup. Output table was analyzed and plotted in Excel v15.22 (Microsoft) and Prism v7.0a (GraphPad).
Supplementary_files_format_and_content: tab-delimited text files contain the coverage and mutation counts for each position along the dme-let-7 sequence.
|
| |
|
| Submission date |
Jun 13, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Brian Reichholf |
| E-mail(s) |
brian.reichholf@imba.oeaw.ac.at
|
| Organization name |
IMBA
|
| Lab |
Stefan Ameres
|
| Street address |
Doktor-Bohr-Gasse 3
|
| City |
Vienna |
| ZIP/Postal code |
1030 |
| Country |
Austria |
| |
|
| Platform ID |
GPL19604 |
| Series (2) |
| GSE99969 |
Thiol-linked alkylation for the metabolic sequencing of RNA [Primer Extension Assays] |
| GSE99978 |
Thiol-linked alkylation for the metabolic sequencing of RNA |
|
| Relations |
| BioSample |
SAMN07225409 |
| SRA |
SRX2914346 |
