|
Status |
Public on Aug 18, 2017 |
Title |
S. pennellii leaf rep1 sRNA-seq |
Sample type |
SRA |
|
|
Source name |
S_pennellii_leaf_rep1
|
Organism |
Solanum pennellii |
Characteristics |
cultivar: LA0716 tissue: leaf age: 2 weeks
|
Growth protocol |
plants were raised from seeds in compost (Levington M3) and maintained in a growth room at 23 $^{o}$C with 16/8 h light/dark periods with 60\% relative humidity, at a light intensity of 150 $\mu$mol photons m$^{-2}$.s$^{-1}$
|
Extracted molecule |
total RNA |
Extraction protocol |
TRIzol extraction sRNAs from leaf (2-week-old seedlings), flower and pollen of M82, \textit{S. pennellii} LA0716 and their F1 were cloned from 10 $\mu$g total RNA using the Illumina TruSeq Small RNA cloning kit and libraries were indexed during the PCR step (12 cycles) according to the manufacturer’s protocol. TruSeq adapter ligation, size selection on gel and amplification
|
|
|
Library strategy |
ncRNA-Seq |
Library source |
transcriptomic |
Library selection |
size fractionation |
Instrument model |
Illumina HiSeq 2000 |
|
|
Data processing |
Sequences were trimmed and filtered with Trim Galore! (with the adapter parameter `-a TGGAATTCTCGGGTGCCAAGG'). Mapping to H06 (S. pennellii and M82 sequences) was performed with Bowtie 1.1.1 (Langmead2009) without mismatches (options `-v 0 -a'). sRNA libraries from IL1-1, IL2-5, IL8-3 and two M82 seedlings were mapped and clustered on Heinz genome SL2.50 using ShortStack v3.3.3 (Axtell2013) with default parameters. sRNA counts on the defined loci were analysed with DESeq2 v1.8.1 (Love2014). Genome_build: Solanum lycopersicum Heinz SL2.50 Supplementary_files_format_and_content: srna_clusters_counts.txt: ShortStack loci and counts in a tab-separated file. H06_sRNA_counts_leaf_flower_pollen.RData:Â segmentSeq alignment data file
|
|
|
Submission date |
Mar 29, 2017 |
Last update date |
May 15, 2019 |
Contact name |
Quentin Gouil |
Organization name |
Walter and Eliza Hall
|
Department |
Epigenetics and Development
|
Lab |
Ritchie lab
|
Street address |
1G Royal Parade
|
City |
Parkville |
State/province |
VIC |
ZIP/Postal code |
3052 |
Country |
Australia |
|
|
Platform ID |
GPL22467 |
Series (2) |
GSE97206 |
Paramutation of natural epialleles in tomato [sRNA] |
GSE97247 |
Paramutation of natural epialleles in tomato |
|
Relations |
BioSample |
SAMN06669361 |
SRA |
SRX2693057 |