 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 12, 2017 |
| Title |
HKE293-Post-DRB-V5ChIP-Rep2 |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T
|
| Organism |
Homo sapiens |
| Characteristics |
rnaseh mutant: D210N
antibody: V5
treatment: After DRB removal for 30min
|
| Treatment protocol |
DRB (100 mM) was added to the medium to the final concentration of 100 μM. Cells were incubated for 2 hrs. To wash off DRB, the DRB-containing medium was aspirated, followed by washing with PBS. Fresh medium was then added and the cells were incubated for 30 min before harvest.
|
| Growth protocol |
HEK293T cells were grown in DMEM supplemented with 10% FBS and 1X penicillin-streptomycin; K562 cells were cultured in RPMI1640 with 10% FBS, 2mM sodium pyruvate and 1X penicillin-streptomycin.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
For R-ChIP, cells expressing mutant RNASEH1 were fixed followed by nuclei extraction. Chromatin DNA was sheared to 250-600 bp in size by sonication followed by incubation with magnetic beads conjugated with anti-V5 antibody overnight at 4°C. Beads were sequentially washed in high salt buffers to remove non-specifically bound protein and chromtin complexes. The enriched RNASEH1-RNA/DNA complex was eluted and decrosslinked overnight at 65°C. After sequential RNase A and Proteinase K treatment, the precipitated hybrid was cleaned by phenol and phenol:chloroform:isoamyl alcohol, followed by ethanol precipitation. The recovered fragment was subjected to library construction. For GRO-seq, the intact nuclei were extracted and mixed with run-on reaction buffer (10 mM Tris-HCl, pH 8.0, 5 mM MgCl2, 300 mM KCl, 1 mM DTT, 200 U/ml RNaseOut, 1% Sarkosyl, 500 μM ATP, 500 μM GTP, 500 μM Br-UTP and 2 μM CTP) for in vitro run-on reaction and Br-U labeling for 5 min at 30°C. The reaction was stopped by adding TRIzol LS reagent (Thermo Fisher). RNA was then extracted followed by treatment wtih DNase I (Promega) and antarctic phosphatase (NEB). For immunopurification, equilibrated and blocked anti-BrdU agarose beads (Santa Cruz) were mixed with RNA for 1 hr at 4°C. After binding, beads were thoroughly washed and BrU-incorporated RNAs were eluted. The BrU-RNA end was repaired by T4 PNK (NEB) and then subjected to poly-A tailing reaction. Tailed RNAs were reverse transcribed into cDNA by using superscript III (Thermo Fisher) and the GRO-seq RT primer (5’-pAGATCGGAAGAGCGTCGTGTAG;GCAGAAGACGGCATACGAGATTTTTTTTTTTTTTTTTTTTVN-3’), where p indicates 5’ phosphate; ‘;’ indicates the abasic dSpacer furan, and VN indicates degenerate nucleotides. The cDNA products were treated with Exonuclease I (NEB) for 1 hr at 37°C to eliminate excessive primer. The resultant cDNA was resolved in 10% polyacrylamide TBE-urea gel and the fraction in the size range of 100-400 bp was excised and recovered.
For R-ChIP library construction, DNA from precipitated RNA/DNA hybrids was used as the template to generate dsDNA by random priming using a tail-containing N9 primer (5’- /invddt/CAAGCAGAAGACGGCATACGAGNNNNNNNNN-3’). An “A” base was then added to the 3’ end and the standard Illumina adaptor was ligated to one end of the resultant dsDNA. After purification,PCR were performed and the libraries in the size range of 130-350 bp were gel-isolated and purified. For GRO-seq library construction, cDNA was circularized and re-linearized. the libraries were amplified by PCR reaction. the final products were resolved in a non-denaturing 10% polyacrylamide TBE gel and libraries with the size 130-250 bp were recovered.
R-ChIP and GRO-seq
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
RNA-DNA hybird
|
| Data processing |
R-ChIP and GRO-seq sequence reads were mapped to the human genome (hg19) via default --local mode of Bowtie2
Repeatedly-mapped reads, reads with low mapping quality (-q 30 for R-ChIP and -q 2 for GRO-seq) and PCR duplicates were discarded according to Samtools
R-ChIP reads were extended to 150 nt (which corresponds to the average size of gel-isolated DNA fragments). We then used MACS2 with default settings to call narrow (or broad when necessary) R-loop peaks. Only confident R-loop peaks with ≥5 folds enrichment and with q-value ≤ 0.001 (or 0.0001 for broad peak) over background were kept for subsequent analyses. GRO-seq reads were extended to 90 nt and were used to estimate the expression level. The expression level in promoter proximal regions was quantified as RPKM in the region -30 to +300 bp from TSS, while the overall gene expression level was defined as RPKM in the downstream region from +300 bp of TSS to gene end.
Genome_build: hg19
Supplementary_files_format_and_content: bigWig file
|
| |
|
| Submission date |
Mar 27, 2017 |
| Last update date |
May 15, 2019 |
| Contact name |
Jia-Yu Chen |
| Organization name |
Nanjing University
|
| Department |
School of Life Sciences
|
| Street address |
No 163 of XianlinAvenue, Qixia District
|
| City |
Nanjing |
| State/province |
CA |
| ZIP/Postal code |
210023 |
| Country |
China |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE97072 |
R-ChIP Using Inactive RNase H Reveals Dynamic Coupling of R-loops with Transcriptional Pausing at Gene Promoters |
|
| Relations |
| BioSample |
SAMN06645257 |
| SRA |
SRX2675021 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2551015_postDRB30min_rep2.m.bw |
28.4 Mb |
(ftp)(http) |
BW |
| GSM2551015_postDRB30min_rep2.p.bw |
28.4 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
