 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Aug 10, 2017 |
| Title |
rB_wt_H3K79me2 |
| Sample type |
SRA |
| |
|
| Source name |
resting B cell
|
| Organism |
Mus musculus |
| Characteristics |
genotype: WT
tissue: spleen
chip antibody: abcam, ab3594
activation time: 0h
|
| Treatment protocol |
Gro-seq: Myc floxed allele was obtained from Douglas Green (St. Jude Children’s research hospital). Myc flox/flox mice (WT) or RosaCreERTam/Myc flox/flox mice (KO) were treated with tamoxifen (three times of i.p. 1mg/mouse at 4, 3 and 1 day before sacrifice). The deletion of floxed allele was checked by PCR or intracellular staining of Myc protein.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
ChIP-Seq: Cultured cells were fixed with 1% formaldehyde (Sigma) for 10’ at 37°C. Fixation was quenched by addition of glycine (Sigma) at a final concentration of 125 mM. Twenty million fixed cells were washed with PBS and resuspended in 1 ml of RIPA buffer (10 mM Tris [pH 7.6], 1 mM EDTA, 0.1% SDS, 0.1% sodium deoxycholate, 1% Triton X-100, 1× Complete Mini EDTA free proteinase inhibitor (Roche)) or stored at −80°C until further processing. Sonication was performed using Covaris S2 sonicator at duty cycle 20%, intensity 5, cycle/burst 200 for 30 min or Branson sonifier at amplitude 35%, 12 cycles of 20” sonication and 30” of pause. For native chip, chromatin was digested with Mnase (Sigma) in digestion buffer (50 mM Tris-HCl, pH7.6, 1 mM CaCl2, 0.2% Triton X-100, butyrate 5 mM) for 5’ at 37°C and dialyzed against RIPA buffer for 2hrs at 4°C. Five micrograms of antibody were incubated with 40 μl of Dynabeads Protein A (or G) for 40 min at room temperature. Antibody-bound beads were added to 500 μl of sonicated or Mnase-digested chromatin, incubated at 4°C overnight, and washed twice with RIPA buffer, twice with RIPA buffer containing 0.3M NaCl, twice with LiCl buffer (0.25 M LiCl, 0.5% Igepal-630, 0.5% sodium deoxycholate), once with TE (pH 8.0) plus 0.2% Triton X-100, and once with TE (pH 8.0). Crosslinking was reversed by incubating the beads at 65°C for 4 hr in the presence of 0.3% SDS and 1 mg/ml Proteinase K. ChIP DNA was purified by phenol-chloroform extraction followed by ethanol precipitation. MNase-Seq: 4x107 resting and activated B cells were digested with 24 different concentrations of MnaseI. After an initial RT-qPCR analysis and curve-fitting, the MnaseI concentrations for the most representative nucleosomal fraction was determined. The lowest three nucleosomal fractions (which corresponded to MnaseI concentrations of 0U, 0U, and 0.0026U) were pooled together and used as input control. Nucleosomal fractions 16-18 (which corresponded to enzyme concentrations of 0.068U, 0.045U, and 0.03U) were also pooled for further processing. Input samples were sonicated to obtain similar fragment sizes as the MnaseI-digested samples. DNA was then concentrated and each sample was spiked with 0.055mg of l DNA (also sonicated to match the sample size as was input DNA). HiC-Seq: we used the same protocol for situ HiC libraries at Rao et al., (Cell, 2014 Dec; 159:1-16) ATAC-Seq: we followed the protocol at Buenrostri J.D. et al. (Nat Methods, 2013 Dec; 10(12):1213-8) Gro-seq: Nuclei was extracted from 8-12 million cells grown on 10 cm plates and after run-on reaction the RNA was extracted with Trizol LS Reagent (Invitrogen, Carlsbad, CA, USA). RNA was treated with TURBO DNase (Ambion), fragmented using RNA Fragmentation Reagents (Ambion) and purified by running through P-30 column (Bio-Rad, Hercules, CA, USA). Fragmented RNA was dephosphorylated with PNK (New England Biolabs, Ipswich, MA, USA) followed by heatinactivation. Dephosphorylation reactions were purified using anti-BrdU beads (SantaCruz Biotech, Santa Cruz, CA, USA) and precipitated overnight. Poly(A)-tailing and cDNA synthesis was performed the next day as described in (Wang et al., 2011). However, for reverse transcription oligos with custom barcodes (underlined) were used : 5’-Phos CA/TG/AC/GT GATCGTCGGACTGTAGAACTCT /idSp/CAAGCAGAAGACGGCATACGA TTTTTTTTTTTTTTTTTTTTVN-3'. After cDNA synthesis, Exonuclease I (New England Biolabs; 30 min) was used to catalyze the removal of excess oligo. Enzyme was inactivated and RNA hydrolyzed by alkaline treatment (100 mM NaOH) and heat (25 min, 95°C). The cDNA fragments of were purified on a denaturing Novex 10% polyacrylamide TBE-urea gel (Invitrogen). The recovered cDNA was circularized, linearized, amplified for 10-14 cycles. The final product was ran on Novex 10%TBE gel, gel purified and cleaned-up using ChIP DNA clean & Concentrator Kit (Zymo Research Corporation, Irvine, CA, USA).
ChIP-Seq : Library was prepared in Ovation SP Ultralow library system (Nugen). 50 cycles of sequencing data were acquired on the HiSeq 2000 or 2500 (Illumina). MNase-Seq: DNA was isolated and prepared for paired-end Illumina sequencing following the genomic DNA protocol. 50 cycles of sequencing data were acquired on the HiSeq 2000 or 2500 (Illumina) ATAC-Seq: DNA was isolated and prepared for paired-end Illumina sequencing following the genomic DNA protocol. 50 cycles of sequencing data were acquired on the HiSeq 2000 or 2500 (Illumina). HiC-seq: DNA was isolated and prepared for paired-end Illumina sequencing following the genomic DNA protocol. 100 cycles of sequencing data were acquired on the HiSeq 2000 or 2500 (Illumina). Gro-seq: 50 cycles of sequencing data were acquired on the HiSeq 2000 (Illumina).
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
base calling: illumina CASAVA 1.8.2
ChIP-Seq_density: alignment: bowtie-1.1.1/bowtie -S -m 1 -p 20 -a --best --strata -n 2 -l 50
ChIP-Seq_density: filtering (uniquely aligned reads): samtools-0.1.19-1.2/samtools view -S -b -F4
ChIP-Seq_density: normalized tag density: custom script, maximum 2 reads with the same start position allowed
Gro-Seq_density: alignment: bowtie-1.1.1/bowtie -S -m 1 -p 20 -a --best --strata -n 2 -l 50 --trim5 2
Gro-Seq_density: filtering (uniquely aligned reads): samtools-1.2/samtools view -S -b -F4
Gro-Seq_density: normalized tag density: bedtools-2.25/genomeCoverageBed -ibam -bg -split -scale normalization_factor -strand, ucsc-314/bedGraphToBigWig
MNaseI-Seq_density: quality and adapter trimming: fqtrim-v0.94/fqtrim -A 125 -q 20 -f adapters -p22 -P33
MNaseI-Seq_density: alignment: bowtie2-2.2.3/bowtie2 --phred 33 --trim3 5 --local --sensitive-local -I 0 -X 1000 --no-discordant --no-mixed --fr --no-unal -p 22
MNaseI-Seq_density: filtering and sorting(uniquely aligned reads): samtools-0.1.19/samtools view -Sb | samtools sort -@ 20 -m 1G
MNaseI-Seq_density: merging: samtools-1.1/samtools merge
MNaseI-Seq_density: raw tag density: custom program, density estimate of nucleosome dyads genome wide, wigToBigWig -fixedSummaries -keepAllChromosomes
MNaseI-Seq_density: tag ratio between input and control: ucsc-314/wiggletools ratio input.bw control.bw | wigToBigWig
MNaseI-Seq_density: aB_minus_rB density: ucsc-314/wiggletools diff aB_ratio.bw rb_ratio.bw | wigToBigWig
ATAC-Seq_density: alignment: bowtie2-2.2.3/bowtie2 --phred 33 --trim3 5 --end-to-end --sensitive-local -I 0 -X 1000 --no-discordant --no-mixed --fr --no-unal -p 16
ATAC-Seq_density: filtering (remove random contigs): sed '/random/d;/chrUn/d'
ATAC-Seq_density: filtering (uniquely aligned reads): samtools-0.1.19/samtools view -S -b -F4
ATAC-Seq_density: merging: samtools-0.1.19/samtools merge && samtools sort -m 10G
ATAC-Seq_density: normalized tag density: custom script, maximum 2 reads with the same start position allowed
HiC-Seq: alignment: bwa-sw with default parameter (map each read separately)
HiC-Seq: filter: remove duplicates and near duplicates, removes reads that map to the same fragemnt and low quality reads (MAPQ <30)
HiC-Seq: contact_matrix: 5kb contact matrix was generated from the filtered alignment
HiC-Seq: loop call: juicebox hiccups -m 500 -r 5000 -k KR -f 0.1 -p 4 -i 10 -t 0.01,1.5,1.75,2 -d 20000
Genome_build: mm9
Supplementary_files_format_and_content: ChIP-Seq: .wig files tag density in 100 nt windows divided by windowsize and library size in millions to obtain normalized read density (rpkm)
Supplementary_files_format_and_content: Gro-Seq: .wig files tag density in 100 nt windows divided by windowsize and library size in millions to obtain normalized read density (rpkm)
Supplementary_files_format_and_content: MNaseI-Seq: .wig files tag density ratio difference between activated and resting B cells (ratio)
Supplementary_files_format_and_content: ATAC-Seq: .wig files tag density in 100 nt windows divided by windowsize and library size in millions to obtain normalized read density (rpkm)
Supplementary_files_format_and_content: HiC-Seq: tab seperated loop coordinates with other information
|
| |
|
| Submission date |
Jun 01, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Seolkyoung Jung |
| Organization name |
NIH
|
| Department |
NIAMS
|
| Lab |
biodata mining and discovery section
|
| Street address |
10 Center Dr
|
| City |
bethesda |
| State/province |
MD |
| ZIP/Postal code |
20892 |
| Country |
USA |
| |
|
| Platform ID |
GPL13112 |
| Series (1) |
| GSE82144 |
Myc regulates chromatin decompaction and nuclear architecture during B cell activation |
|
| Relations |
| BioSample |
SAMN05195409 |
| SRA |
SRX1815495 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2184282_rB_wt_H3K79me2.bw |
52.3 Mb |
(ftp)(http) |
BW |
SRA Run Selector |
| Processed data provided as supplementary file |
| Raw data are available in SRA |
|
|
|
|
 |
