 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 27, 2016 |
| Title |
Tet_TKO2_E6.6_Epiblast_PBAT |
| Sample type |
SRA |
| |
|
| Source name |
Epiblast of E6.5
|
| Organism |
Mus musculus |
| Characteristics |
tissue: Epiblast
age: Embryonic day 6.5
genotype: Tet1-/- Tet2-/- Tet3-/-
strain: C57BL/6J-129Sv
|
| Treatment protocol |
A pool of 23 WT and 26 Tet-null fresh epiblasts were disrupted and homogenized in Buffer RLT Plus respectively, then snap-frozen in liquid nitrogen and stored at -80 ºC.
|
| Growth protocol |
For embryo preparation, mice were maintained on a 12/12 h light/dark cycle. After mating, the morning of appearance of a vaginal plug was designated as embryonic day 0.5 (E0.5). On day 7 of pregnancy, corresponding to E6.5, embryos were recovered carefully from uteri and isolated from decidua using fine forceps and a needle under a dissecting microscope. After incubation in PBS with 0.25% pancreatin (Sigma, P7545) and 0.05% trypsin (Gibco, 27250-018) for 10 minutes at 4 °C, embryos were transferred to Dulbecco's Modified Eagle Medium (DMEM) (Invitrogen) supplemented with 10% FBS and then the visceral endoderm layer was detached from embryos by being gently aspirated through a mouth pipette several times. The epiblast was separated from the extraembryonic ectoderm using a fine tungsten needle. The visceral endoderm layer or the extraembryonic ectoderm was used for genotyping.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
DNA was extracted from isolated epiblasts by using the Qiagen AllPrep DNA/RNA Mini Kit.
About 5 ng genomic DNA were used to construct the PBAT library using the protocol slightly modified from previously published. Briefly, the isolated genomic DNAs, together with 1% unmethylated lambda DNA (Thermo Scientific), were converted and purified with MethylCode Bisulfite Conversion kit (Invitrogen) following the manufacturer’s instructions. Then random nonamer primers with a 5’ biotin tag and a truncated Illumina P5 adaptor (5’-biotin-CTACACGACGCTCTTCCGATCTNNNNNNNNN-3’) and 50 units of Klenow polymerase (3’ to 5’ exo-, NEB) were used to amplify the bisulfite-converted templates linearly. The excess primers remained in last reaction were removed using 40U Exonuclease I (NEB) before amplified products were purified with 0.8 x Agencourt Ampure XP beads (Beckman Coulter). The newly synthesized DNA strands with biotin were captured with Dynabeads M280 Streptavidin (Invitrogen), and the original bisulfite-treated DNA templates were washed away by 0.1 N NaOH. The second strands were synthesized using 50 units Klenow polymerase with random nonamer primers containing a truncated P7 Illumina adaptor (5’-AGACGTGTGCTCTTCCGATCTNNNNNNNNN-3’). The beads with double strand DNA products were further collected and washed several times, and the libraries were generated with 5-6 cycles of PCR amplifications using 1 unit KAPA HiFi HS DNA Polymerase (KAPA Biosystems), together with 0.4 μM Illumina Forward PE1.0 primer (5’-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-3’) and 0.4 μM pre-indexed Illumina Reverse primer (5’- CAAGCAGAAGACGGCATACGAGATXXXXXXGTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT-3’; the underlined hexamer indicates the index sequences). Amplified libraries were purified with 0.8 x Agencourt Ampure XP beads twice and were assessed with the Fragment Analyzer (Advanced analytical) and quantified with a standard curve-based qPCR assay (Roche). The final quality-ensured libraries were pooled and sequenced on the Illumina X Ten sequencer for 150 bp paired-end sequencing.
whole-genome bisulfite sequencing by post-bisulfite adaptor tagging (PBAT)
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
HiSeq X Ten |
| |
|
| Data processing |
library strategy: whole-genome bisulfite sequencing by post-bisulfite adaptor tagging (PBAT)
For data from Illumina, Illumina CASAVA version 1.8 were used to the basecalling.
Adaptor contamination and low-quality reads were discarded from the raw data.
For RNA-Seq Illumina paired-end reads, TopHat (version 2.0.10) were used for sequence alignment, and nCount values were generated by HTSeq(version 0.6.1) and then normalized by DESeq2(version 1.6.1).
For PBAT DNA illumina paired-end reads,Bismark(version 0.7.6) were use for sequence alignment, and SingleC data were generated by SAMtools(version 0.1.19-44428cd)
Bisulfite conversion rate was estimated by the lambda genome, which was built as the extra chromosome.
Genome_build: mm9, J02459.1
Supplementary_files_format_and_content: SingleC data were generated by SAMtools(version 0.1.19-44428cd)
|
| |
|
| Submission date |
Jan 06, 2016 |
| Last update date |
May 15, 2019 |
| Contact name |
Rui WANG |
| E-mail(s) |
fish_cat_wr@sina.cn
|
| Phone |
15801166445
|
| Organization name |
Peking University
|
| Department |
Biodynamics Optical Imaging Center (BIOPIC)
|
| Lab |
Fuchou Tang
|
| Street address |
No.5 Yiheyuan Road, Haidian District
|
| City |
Beijing |
| ZIP/Postal code |
100871 |
| Country |
China |
| |
|
| Platform ID |
GPL21273 |
| Series (1) |
| GSE76261 |
DNA demethylation by Tet dioxygenases controls gastrula patterning by regulating Lefty-Nodal signaling |
|
| Relations |
| BioSample |
SAMN04386719 |
| SRA |
SRX1519760 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM2028284_Tet_TKO2_E6.5_Epiblast.SingleCmet.txt.gz |
2.3 Gb |
(ftp)(http) |
TXT |
| GSM2028284_Tet_TKO2_E6.5_Epiblast.SingleCmet_lambda.txt.gz |
410.8 Kb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
| Processed data are available on Series record |
|
|
|
|
 |
