|
| Status |
Public on Dec 07, 2015 |
| Title |
4C_HoxD_bait2_2i |
| Sample type |
SRA |
| |
|
| Source name |
Embryonic stem cells
|
| Organism |
Mus musculus |
| Characteristics |
developmental stage: E14
chip antibody: none
|
| Treatment protocol |
2i mESCs were grown in serum free NDiff 227 supplemented with MEK inhibitor PD0325901 (1µM) and GSK3 inhibitor CHIR99021 (3µM) in presence of LIF.
|
| Growth protocol |
All cell-culture was conducted in feeder-free condition.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Libraries were prepared according to Illumina's instructions.
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina NextSeq 500 |
| |
|
| Description |
4C PCR product. Barcode: ACAGTTCTGCAAGAAAGCTT
|
| Data processing |
Illumina Casava software 1.8.2 used for basecalling of Hiseq2000 and NextSeq 500 data.
Library strategy: ChIP-seq. The reads were aligned to build version mm9 of the mouse genome using bwa (version 0.7.12) with default parameters. Only uniquely mapped reads were kept for downstream analysis. Reads from PCR duplicates were also removed. MACS (version 2.0.10.20130306), was used to identify regions of ChIP-seq enrichment over background using parameters --nomodel --broad.
Library strategy: RNA-seq. MMSEQ package was used to infer gene expression levels. Reads were mapped to mouse gene annotation (Ensemble release 67).
Library strategy: Capture Hi-C. The two ends of paired-end reads were mapped to the reference mouse genome (mm9) separately, using BWA MEM (version 0.7.12) with default parameters. Reads were filtered based on mapping quality score (both ends mapQ ≥ 10) and PCR duplicates were removed. Reads were removed if the two ends are from the same DpnII fragment. CHICAGO CHi-C analysis package (http://regulatorygenomicsgroup.org/chicago) was used to call significant contacts. To increase quality, the whole genome was windowed into 5 DpnII site tiles. Virtual baits were created by merging adjacent target regions. Interactions were filtered based on interaction score and number of reads (score ≥ 5 and at least 5 reads).
Library strategy: DNaseI-seq. The reads were aligned to build version mm9 of the mouse genome using bwa (version 0.7.12) with default parameters. Only uniquely mapped reads were kept for downstream analysis. Reads from PCR duplicates were also removed. MACS (version 2.0.10.20130306), was used to identify DNaseI hyper-sensitive sites using parameters --nomodel --broad.
Library strategy: 4C-seq. The initial step in the 4C-seq analysis is the alignment of the sequencing reads to a reduced genome of sequences that flank HindIII sites (fragment ends). Repetitive fragment ends were excluded from subsequent analysis. The reduced genome was based on mouse genome mm9.
Genome_build: mm9
|
| |
|
| Submission date |
Oct 14, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Shuang-Yin Wang |
| Organization name |
RIMLS
|
| Department |
Molecular Biology
|
| Street address |
Geert Grooteplein 28
|
| City |
Nijmegen |
| ZIP/Postal code |
6525GA |
| Country |
Netherlands |
| |
|
| Platform ID |
GPL19057 |
| Series (1) |
| GSE72164 |
Dynamic reorganization of extremely long-range promoter-promoter interactions between two states of pluripotency |
|
| Relations |
| BioSample |
SAMN04166292 |
| SRA |
SRX1335179 |
