|
| Status |
Public on Nov 15, 2015 |
| Title |
Huh-7.5 CLEAR-CLIP3 |
| Sample type |
SRA |
| |
|
| Source name |
Huh-7.5 hepatoma cells
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: Huh-7.5
|
| Treatment protocol |
LNA-122, miravirsen or siRNA treatment, or HSPC117 over-expression according to protocol described in accompanying publication.
|
| Growth protocol |
Huh-7.5 cell culture
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Huh-7.5 cells were UV-irradiated. AGO-cross-linked RNA was isolated with the Std. AGO-CLIP or CLEAR-CLIP protocol described in detail in the accompanying publication.
AGO-cross-linked RNA was cloned by addition of pre-adenylated 3' linker and RNA 5' linker, then RT-PCR, as described in the published CLEAR-CLIP protocol. Products were amplified in a second round of PCR that added a 4 nt index (for multiplexing, see above) and 16 nt common primer sequence. Raw files are demultiplexed on the basis of this index, but have not been further modified.
|
| |
|
| Library strategy |
RIP-Seq |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
protocol: CLEAR-CLIP
complex MW (kD): 130-180
multiplex index: TACG
RNAse A (low), no T4 RNA ligase
|
| Data processing |
base calling: Casava 1.8.2
quality filtering: minimum quality filter applied for barcode and insert: fastq_filter.pl; -if sanger -f min:0-3:20,mean:20-40:20 -maxN -1 -v -of fasta ; http://sourceforge.net/projects/ngs-cims/files/CIMS.v1.0.5.tgz/download
collapse exact sequences: exact duplicate sequences removed: fasta2collapse.pl; ; http://sourceforge.net/projects/ngs-cims/files/CIMS.v1.0.5.tgz/download
remove 3' adapter sequene: 3' adapter GTGTCAGTCACTTCCAGCGG clipped: fastx Clipper; -l 20 -a GTGTCAGTCACTTCCAGCGG -n; http://hannonlab.cshl.edu/fastx_toolkit/
trim 5' adapter sequence: 5' 20 nucleotides trimmed (NNNNAGGGAGGACGATGCGG, where NNNN is 4 nucleotide index for multiplexing): fastx Trimmer; -f 21; http://hannonlab.cshl.edu/fastx_toolkit/
strip 5' degenerate linker: 5 nucleotide (NNNNG) degenerate barcode stripped and appended to read IDs: stripBarcode.pl; -linker 5 ; http://sourceforge.net/projects/ngs-cims/files/CIMS.v1.0.5.tgz/download
alignment against micoRNA database: microRNA database mapped against sample file (treated as reference genome) to identify potential chimeric reads containing microRNA sequence: Bowtie; -n 1 -l 8 -e 35; http://bowtie-bio.sourceforge.net/index.shtml
extract chimeric read: extract potential chimeric sequence 5' or 3' of mapped microRNA sequence: text manipulation in R; ;
alignment against genome reference: alignment ofpotential chimeric reads against reference genome to identify target sites: Bowtie; -n 1 -l 8 -e 35; http://bowtie-bio.sourceforge.net/index.shtml
collapse PCR duplicates: mapped reads with same 5' end and same degenerate barcode consolidated: tag2collapse.pl; keep-tag-name --keep-max-score --random-linker -EM 30 --seq-error-model em-local --weight --weight-in-name ; http://sourceforge.net/projects/ngs-cims/files/CIMS.v1.0.5.tgz/download
clustering : chimera interactions with the same ligated microRNA and overlapping genomic coordinates were clustered: Genome_Intervals R package; ;
Genome_build: hg18
Supplementary_files_format_and_content: Excel spreadsheet with gene coordinate information and additional annotations for chimera-identified interactions
|
| |
|
| Submission date |
Sep 15, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
Michael John Moore |
| Organization name |
The Rockefeller University
|
| Department |
Molecular Neuro-Oncology
|
| Lab |
Robert Darnell
|
| Street address |
1230 York Ave Box 226
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (2) |
| GSE73057 |
miRNA-target chimeras identified with CLEAR-CLIP reveal miRNA 3' end pairing as a major determinant of Argonaute binding in vivo [human Huh7.5 AGO-CLIP & CLEAR-CLIP] |
| GSE73059 |
miRNA-target chimeras identified with CLEAR-CLIP reveal miRNA 3' end pairing as a major determinant of Argonaute binding in vivo |
|
| Relations |
| BioSample |
SAMN04088104 |
| SRA |
SRX1247130 |
