 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 09, 2015 |
| Title |
Gallus gallus_CHL1_JIIT4DS1_HH24 |
| Sample type |
SRA |
| |
|
| Source name |
Heart _HH24
|
| Organism |
Gallus gallus |
| Characteristics |
tissue: heart
developmental stage: HH24
|
| Growth protocol |
Fertilized Gallus gallus chicken eggs were obtained from Hatcheries, Faridabad, Haryana, India. The eggs were incubated in an incubator at 37.5°C with more than 90% humidity and with rotations every 6 h. Chick embryos were collected at days four, six, eight, ten, twelve and fourteenth day of incubation [CHL1–CHL6] and selected to represent the embryonic developmental stages 24, 29, 34, 36, 38 and 40 respectively .
|
| Extracted molecule |
total RNA |
| Extraction protocol |
Total RNA was isolated from each six stage of developing chick heart and small RNA was isolated using Ambion mirVana miRNA Isolation Kit. The quality and Integrity of small RNA was checked by Agilent 2000 bioanalyzer. Small RNA cDNA was constructed for each six samples using ScriptSeq RNA-Seq Library Preparation Kit and libraries were constructed .
Total six cardiac heart libraries (CHL1 to CHL6) were prepared for deep sequencing and subsequent characterization. For that total RNA samples from each stage were prepared. The low-molecular- weight RNA was precipitated with PEG8000/NaCl. RNA was purified by polyacrylamide gel electrophoresis [PAGE] to elute molecules in the range of 18–30nt. The extracted RNAs were ligated to the 3′ adapter [TCGTATGCCGTCTTCTGCTTG]. The ligated RNAs from each library were eluted from 15% denatured polyacrylamide gel using 0.3N NaCl, followed by the ligation of 5′ adapter [GTTCAGAGTTCTACAGTCCGACGATC]. The samples were further used as templates for cDNA synthesis using small RNA v1.5 cDNA synthesis kit (illumine) by using primers complementary to 5’ and 3’ adapter sequences with 25 PCR cycles of 95°C for 30s, 50°C for 30s, and 72°C for 30s. The PCR products were extracted from the agarose gels using the Gel Extraction Kit [Qiagen]. For each heart developmental stage, equal quantities [20μg] of small RNA were submitted to Illumina Inc.for small RNA deep sequencing.
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina Genome Analyzer |
| |
|
| Description |
small RNA
CHL1
|
| Data processing |
The sequence retrived after high throughput sequencing using illumina platform was further aligned with chicken genome using TopHat alignment and cufflinks assembly
Small RNA's (piRNA, miRNA, miRNA like, snoRNAs and snRNAs)annotations using Software Rfam
Identification of known and novel miRNAs using miRBase 19.0v database
miRNA target prediction using Target scan 6.0v and miRanda
Expression analysis for known and novel miRNAs using RNA Express
|
| |
|
| Submission date |
Jun 08, 2015 |
| Last update date |
May 15, 2019 |
| Contact name |
vibha rani |
| E-mail(s) |
vibha.rani@jiit.ac.in
|
| Phone |
9891854349
|
| Organization name |
Jaypee Institute of Information Technology
|
| Department |
Biotechnology
|
| Street address |
A-10, sector 62
|
| City |
Noida |
| State/province |
UP |
| ZIP/Postal code |
201307 |
| Country |
India |
| |
|
| Platform ID |
GPL10223 |
| Series (1) |
| GSE69663 |
Comparative Characterization of Cardiac Development Specific microRNAs: Fetal Regulators for Future |
|
| Relations |
| BioSample |
SAMN03765166 |
| SRA |
SRX1053578 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1705503_Known_Novel_and_Expression_of_miRNACHL1.xls.gz |
13.9 Kb |
(ftp)(http) |
XLS |
| GSM1705503_Target_Prediction_miRNA_CHL1.xlsx |
34.7 Kb |
(ftp)(http) |
XLSX |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
