NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1648133 Query DataSets for GSM1648133
Status Public on Jun 25, 2015
Title replicate2 siTTK gene at 24h U251
Sample type protein
 
Source name U251-GBM cell line
Organism Homo sapiens
Characteristics cell line: U251
treatment: siTTK gene at 24h
Treatment protocol siRNA transfections, 2-pmol siMPS1, (5’ TTGGACTGTTATACTCTTGAA3’, SI00071624, siMiR21 (GeneSolution siRNA cat: 1027416 (mix of 4 validated anti Hs_MiR21)) (Qiagen Inc., Germantown, MD) was complexed with RNAi Max lipid transfection reagent (Invitrogen) in DMEM media for 15 minutes at ambient temperature.For NMS-P715 mediated inhibition of MPS1, cells were plated Overnight prior to drug treatment and treated with NMS-P715 at the concentrations indicated in each experiment.Proteins for RPPAt analysis was harvested 24 and 48 hours post siRNA transfection or Drug treatments
Growth protocol U251, U87 (National Cancer Institute Frederick Tumor Repository) human GBM cell lines were grown in Dulbecco's Modified Eagle Medium (DMEM) (Invitrogen, Carlsbad, CA) with 10% fetal bovine serum (FBS), and maintained at 37°C, 5% CO2.
Extracted molecule protein
Extraction protocol Treated GBM cell (U251,U87) lysates were prepared in RPPA lysis buffer [1% Triton X-100, 50 nmol/L Hepes (pH 7.4), 150 nmol/L NaCl, 1.5 nmol/L MgCl2, 1 mmol/L EGTA, 100 nmol/L NaF, 10 nmol/L NaPPi, 10% glycerol, 1 nmol/L phenylmethylsulfonyl fluoride, 1 nmol/L Na3VO4, and aprotinin 10 μg/mL) as described elsewhere, and sent to RPPA Core Facility, MD Andersen Cancer Center, Houston, TX for RPPA analysis.
Label DAB
Label protocol visualized by DAB colorimetric reaction
 
Hybridization protocol 5 serial dilutions of lysates were arrayed on nitrocellulose‐coated slides, probed with (172 phosphorylated and non- phosphorylated) antibodies. Samples were probed with antibodies by a tyramide amplification approach (Dako CSA) and visualized by DAB colorimetric reaction.
Scan protocol Slides were scanned on a flatbed scanner to produce 16-bit tiff images. Spots from tiff images were identified and the density was quantified by Array-Pro Analyzer software.
Description protein lysate
siTTK 24hr U251-b
Data processing Relative protein levels for each sample were determined by interpolation of each dilution curves from the standard curve antibody slide. All the data points were normalized for protein loading and transformed to a linear value. Linear values were transformed to Log2 value and then median‐centered for hierarchical cluster analysis.
 
Submission date Apr 01, 2015
Last update date Jun 25, 2015
Contact name Uma T Shankavaram
E-mail(s) uma@mail.nih.gov
Phone 301-496-6718
Organization name NIH
Department NCI
Lab Radiation Oncology Branch
Street address 9000 Rockville Pike
City Bethesda
State/province MD
ZIP/Postal code 20892
Country USA
 
Platform ID GPL19976
Series (1)
GSE67502 Reverse phase protein arrays (RPPAs): effects of MPS1 inhibition on signaling pathways in GBM cells

Data table header descriptions
ID_REF
VALUE All the data points were normalized for protein loading and transformed to a linear value

Data table
ID_REF VALUE
14-3-3_beta-R-V 0.177061399
14-3-3_epsilon-M-C -0.00889309
14-3-3_zeta-R-V -0.049777601
4E-BP1-R-V -0.077528119
4E-BP1_pS65-R-V -0.143552454
4E-BP1_pT37_T46-R-V -0.115373619
53BP1-R-V -0.137032753
ACC_pS79-R-V -0.036273437
ACC1-R-E -0.391089965
ACVRL1-R-C 0.104337655
Akt-R-V -0.27810678
Akt_pS473-R-V -0.025593829
Akt_pT308-R-V 0.253533867
AMPK_alpha-R-C -0.14025573
AMPK_pT172-R-V 0.564546115
Annexin_VII-M-V 0.094118772
AR-R-V -0.040359919
B-Raf-M-C -0.189205748
Bad_pS112-R-V 0.174154549
Bak-R-C 0.055088995

Total number of rows: 172

Table truncated, full table size 4 Kbytes.




Supplementary data files not provided
Processed data included within Sample table
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap