GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1604247

Query DataSets for GSM1604247

Status

Public on Apr 20, 2015

Title

pKO-a_D4

Sample type

SRA

Source name

Haunt pKO mES cells

Organism

Mus musculus

Characteristics

sample type: Haunt promoter knockout in 46C cells (RA, day4)
treatment: LIF withdrawal, 2uM RA, day4
strain: 129/Ola
chirp probes: none
genotype: Haunt pKO
cell line: 46C
cell type: embryonic stem cells
chip antibody: none

Growth protocol

ESCs were cultured in N2B27 complete "2i" medium including: 100 ml DMEM/F12 basal medium (Life Technologies), 100 ml Neurobasal medium (Life Technologies), 1 ml N2 supplement (Life Technologies), 2 ml B27 supplement (Life Technologies), 1 ml 100 × Glutamax (Life Technologies) and 0.1 mM 2-mercaptoethanol, 1000U/ml recombinant leukemia inhibitory factor (LIF, millipore) and "2i" (1 uM PD03259010, 3 uM CHIR99021) for one day. The cells were then passaged with N2B27 medium without LIF and "2i", and supplemented with 2 uM retinoic acid (RA), change medium everyday. Cells were harvested at day 4 of RA-induced differentiation
Wild-type ESCs or Haunt KO ESCs were maintained in strandard ES medium supplemented with 15% heat-inactivated FCS, 1% of nucleoside mix (100 × stock, Millipore), Penicillin-Streptomycin Solution (100 × stock, Life Technologies), 2 mM Glutamax (100 × Life Technology), 0.1 mM non-essential amino acid, 0.1 mM 2-mercaptoethanol and supplied with 1000 U/ml recombinant leukemia inhibitory factor (LIF, millipore).

Extracted molecule

total RNA

Extraction protocol

Cells were harvested at day 4 of RA-induced differentiation. TRIzol reagent was added directly into the plate after cold 1 × PBS wash once. The total RNA was extracted according to manufacturer's instructions. mRNA was further isolated by Dynabeads mRNA purification kit (Life Technologies) according to manufacturer's instructions.
The library was constructed by library preparation modules (New England Biolabs) according to manufacturer's instructions. Briefly, mRNA was fragmentated by NEBNext Magnesium RNA Fragmentation Module at 94 ℃ for 5 min. The fragementated RNA was reverse transcribed by SuperScript III First-Strand Synthesis System for RT-PCR kit (Life Technology), 2'nd strand was then synthesized by NEBNext mRNA Second Strand Synthesis Module , the end repair, dA-tailing and adaptor ligation were also following the instruments by respect module. the adaptor for the libary was sythersized from IDT. After liagation, the DNA was amplified by primer 1.0 (AATGATACGGCGACCACCGAGATCTACAC, synthersized from IDT) and 2.0 (CAAGCAGAAGACGGCATACGAGAT, synthersized from IDT) for 12 cycles. After this, the product was further purified and size selected by Ampure XP beads (Beckman Coulter). The library was sequenced on the Genome Analyzer following the manufacturer's protocols.
Total RNA of RNA-Seq were extracted by TRIzol reagent according to manufacturer's instruction. mRNA were further isolated by Dynabeads mRNA purification kit (Life Technologies) according to manufacturer's instruction.
Libraries were prepared by illumina TruSeq Stranded mRNA LT Sample Prep Kit (RS-122-2101) according to the standard protocols of the manufacturer. ChIRP retrieved DNA-seq were prepared by library preparation modules (New England Biolabs) according to manufacturer's instructions.

Library strategy

RNA-Seq

Library source

transcriptomic

Library selection

cDNA

Instrument model

Illumina HiSeq 2000

Description

Haunt RA_RNA profiling.xlsx

Data processing

Basecalls performed using CASAVA version
ChIRP retrived DNA-Seq reads were aligned to the mm9 genome assembly using Bowtie version 1.0.0 with the default parameters
RNA-seq reads were aligned to the mm9 genome assembly using Tophat v2.0.11,allowing for uniquely mapped reads and mapping both spliced and unspliced reads.
FPKM was calculated by Cufflink 2.1.1
Peaks of each sample were called using MACS v. 1.4.2
Genome_build: mm9
Supplementary_files_format_and_content: tab-delimited text files include RPKM values for wild-type or Haunt KO Samples, bedgraph files were generated using MACS v. 1.4.2, including peaks called by default parameters.

Submission date

Feb 09, 2015

Last update date

May 15, 2019

Contact name

jinlong lu

E-mail(s)

bioyuyang@hotmail.com

Phone

5853098469

Organization name

University of Rochester