GEO Accession viewer

NCBI > GEO > Accession Display

Not logged in | Login

GEO help: Mouse over screen elements for information.

Sample GSM1519178

Query DataSets for GSM1519178

Status

Public on Dec 04, 2014

Title

H3K4me3_AIDtg_clone26

Sample type

SRA

Source name

RAMOS

Organism

Homo sapiens

Characteristics

genotype/variation: MSH2-/-; AIDtg; UGItg
tissue: Burkitt's lymphoma cell line
chip antibody: Anti-trimethyl-Histone H3 (Lys4)
chip antibody vendor: Millipore
chip antibody cat. #: 04-745

Extracted molecule

genomic DNA

Extraction protocol

ChIP-Seq: Cultured cells were fixed with 1% formaldehyde (Sigma) for 10’ at 37°C. Fixation was quenched by addition of glycine (Sigma) at a final concentration of 125 mM. Twenty million fixed cells were washed with PBS and resuspended in 1 ml of RIPA buffer (10 mM Tris [pH 7.6], 1 mM EDTA, 0.1% SDS, 0.1% sodium deoxycholate, 1% Triton X-100, 1× Complete Mini EDTA free proteinase inhibitor (Roche)) or stored at −80°C until further processing. Sonication was performed using Covaris S2 sonicator at duty cycle 20%, intensity 5, cycle/burst 200 for 30 min or Branson sonifier at amplitude 35%, 12 cycles of 20” sonication and 30” of pause. For native chip, chromatin was digested with Mnase (Sigma) in digestion buffer (50 mM Tris-HCl, pH7.6, 1 mM CaCl2, 0.2% Triton X-100, butyrate 5 mM) for 5’ at 37°C and dialyzed against RIPA buffer for 2hrs at 4°C. Five micrograms of antibody were incubated with 40 μl of Dynabeads Protein A (or G) for 40 min at room temperature. Antibody-bound beads were added to 500 μl of sonicated or Mnase-digested chromatin, incubated at 4°C overnight, and washed twice with RIPA buffer, twice with RIPA buffer containing 0.3M NaCl, twice with LiCl buffer (0.25 M LiCl, 0.5% Igepal-630, 0.5% sodium deoxycholate), once with TE (pH 8.0) plus 0.2% Triton X-100, and once with TE (pH 8.0). Crosslinking was reversed by incubating the beads at 65°C for 4 hr in the presence of 0.3% SDS and 1 mg/ml Proteinase K. ChIP DNA was purified by phenol-chloroform extraction followed by ethanol precipitation. RNA-Seq: Total RNA from 1e6 activated B cells was isolated by Trizol extraction. 4C-Seq: Ten million mouse B cells were crosslinked in 2% formaldehyde at room temperature for 10 min. The reaction was quenched by the addition of glycine (final concentration of 0.125 M). Cells were then washed with cold PBS and lysed (10 mM Tris-HCl, pH 8.0, 10 mM NaCl, 0.2% NP-40, 1× complete protease inhibitors (Roche)) at 4 °C for 1 h. Nuclei were incubated at 65 °C for 30 min, 37 °C for 30 min in 500 μl of restriction buffer (New England Biolabs DpnII buffer) containing 0.3% SDS. To sequester SDS, Triton X-100 was then added to a final concentration of 1.8%. DNA digestion was performed with 400 U of DpnII (New England Biolabs) at 37 °C overnight. After heat inactivation (65 °C for 30 min), the reaction was diluted to a final volume of 7 ml with ligation buffer containing 100 U T4 DNA Ligase (Roche) and incubated at 16 °C overnight. Samples were then treated with 500 μg Proteinase K (Ambion) and incubated overnight at 65 °C to reverse formaldehyde crosslinking. DNA was then purified by phenol extraction and ethanol precipitation. For circularization, the ligation junctions were digested with Csp6I (Fermentas) at 37 °C overnight. After enzyme inactivation and phenol extraction, the DNA was religated in a 7-ml volume (1,000 U T4 DNA Ligase, Roche). Three micrograms of 4C library DNA was amplified with Expand Long template PCR System (Roche). Thermal cycle conditions were DNA denaturing for 2 min at 94 °C, followed by 30 cycles of 15 s at 94 °C, 1 min at 58 °C, 3 min at 68 °C, and a final step of 7 min at 68 °C. Baits were amplified with inverse PCR primers as follows: Il4ra with DpnII_4C 5′-TCAGGTAGTTCCATGGGATC-3′, Il4ra_Csp6i 5′-ATCTCTGCACCAGACATCAG-3, IL21r_DpnII: CCAGACCTACTTAGCAGATC, and IL21r_Csp6i: ACTTAGACACTGCTCAGCTG. ChIA-PET: RNA PolII ChIA-PET was performed as previously described (Fullwood et al., 2009, Goh et al., 2012 and Li et al., 2012). Briefly, RAMOS cells (up to 3e9 cells) were treated with 1% formaldehyde at room temperature for 10 min and then neutralized using 0.2 M glycine. The crosslinked chromatin was subjected to fragmentation with an average length of 300 bp by sonication. The anti-PolII monoclonal antibody 8WG16 (Covance, MMS-126R) was used to enrich PolII-bound chromatin fragments. A portion of ChIP DNA was eluted off from antibody-coated beads for concentration quantification using Picogreen fluorimetry and for enrichment analysis using quantitative PCR.
ChIP-Seq and 4C: DNA was blunt-ended with End-It DNA end repair kit (Epicenter) and A-tailed with Taq DNA polymerase (Invitrogen) in the presence of 200mM of dATP for 40 min at 70°C. Samples were purified by phenol-chloroform extraction after each reaction. Illumina compatible adaptors (Bioo Scientific) were then ligated with T4 DNA ligase (Enzymatics), and the reaction was purified once with AMpure XP magnetic beads (Beckman Coulter). Samples were PCR amplified for 12~15 cycles with KAPA HiFi DNA polymerase mix (KAPA Biosystems) and run on a 2% agarose gel and size-selected at 250–350 bp. 50 cycles of sequencing data were acquired on the HiSeq 2000 or 2500 (Illumina). RNA-Seq: Standard RNA-Seq library preparation was performed following Illumina’s RNA-Seq protocol v2. ChIA-PET: For ChIA-PET library construction ChIP DNA fragments from two biological replicates were end-repaired using T4 DNA polymerase (NEB) and ligated to either linker A or linker B. Other than four nucleotides in the middle of the linkers that were used as nucleotide barcode, the two linkers share the same nucleotide sequences. After linker ligation, the two samples were combined for proximity ligation in diluted conditions. During the proximity ligation, DNA fragments within the same ChIP complex with the same linker were ligated, which generated the ligation products with homodimer linker composition. However, chimeric ligations between ChIP fragments that are bound in different chromatin complexes could also occur, thus producing ligation products with heterodimer linker composition. Following proximity ligation, the Paired-End-Tag (PET) constructs were extracted from the ligation products and the PET templates were subjected to paired-end sequencing using Illumina HiSeq.

Library strategy

ChIP-Seq

Library source

genomic

Library selection

ChIP

Instrument model

Illumina HiSeq 2500

Description

Genetically engineered RAMOS cell line. Cells have a defect in missmatch and base excision repair and overexpress AID to reveal AID dependent mutations.
processed data file: AIDtgMSH2mmUgi.SNPs.bed.gz; Hotspots.AIDtgMSH2mmUgi.bed.gz; RAMOS_H3K4me3.wig.gz; RAMOS_H3K4me3.peaks.bed.gz

Data processing

base-calling: Illumina CASAVA 1.8.0 to 1.8.2
ChIP-Seq_density: alignment: bowtie-0.12.8/bowtie -S -m 1 -p 20 -a --best --strata -n 2
ChIP-Seq_density: filtering (uniquely aligned reads): samtools-0.1.18/samtools view -S -b -F4
ChIP-Seq_density: normalized tag density: custom script, maximum 2 reads with the same start position allowed
ChIP-Seq_SE: alignment: bowtie-0.12.8/bowtie -S -m 1 -p 20 -a --best --strata -n 2
ChIP-Seq_SE: peak calling: MACS 1.4.2 with the flag ‘-p 1e9’
ChIP-Seq_SE: Super-enhancer calling: ROSE (https://bitbucket.org/young_computation/rose.git) with ‘TSS_EXCLUSION_ZONE_SIZE=2000’
ChIP-Seq_mutations: align and fix read group: bwa 0.6.2-r126 ‘bwa aln –B 3 –n 2’ and ‘bwa samse –r <new_read_group_string>’
ChIP-Seq_mutations: flag and sort bam files: ‘samtools view –S –b –F4’ and 'samtools sort'
ChIP-Seq_mutations: deduplicate: picard 1.7.9 MarkDuplicates with ‘REMOVE_DUPLICATES=true
ChIP-Seq_mutations: GATK, version 2.5-2 RealignerTargetCreator (default settings)
ChIP-Seq_mutations: GATK, version 2.5-2 IndelRealigner with the flag ‘--consensusDeterminationModel KNOWNS_ONLY’
ChIP-Seq_mutations: GATK, version 2.5-2 BaseRecalibrator (default settings)
ChIP-Seq_mutations: GATK, version 2.5-2 PrintReads (default settings)
ChIP-Seq_mutations: GATK, version 2.5-2 UnifiedGenotyper with the flags ‘-stand_call_conf 4 -stand_emit_conf 4’
ChIP-Seq_mutations: hard filtering : custom software (python, bash) > 5bp from known indels; QUAL >= 20; GQ >= 20; DP >=3; callable in both WT replicates >=1 mutant sample
ChIP-Seq_mutations: SNP counts: custom software (R version 3.1.1 (2014-07-10)) remove AIDmm positions, count SNPs and callable bases per peak, obtain p-values using binomial distribution, BH correction
RNA-Seq: alignment: gsnap v. 2013-05-09
RNA-Seq: alignment: normalized coverage: custom software
4C: bowtie-1.0; create bowtie index of all mm9 DpnII restriction fragment ends (40 bp from cut site)
4C: custom software; analyzed read pairs for presence of correct bait sequence
4C: bowtie 1.0; if bait sequence present, align second read to DpnII fragment ends
4C: custom software, count number of hits to the left and right end of each DpnII fragment
4C: For the analysis of local data, fragment densities were normalized and displayed as described in [Van de Werken et al., PMID: 22961246]
ChIA-PET: Chia-PET tool: collapse redundant reads into non-redundant PET sequence
ChIA-PET: Chia-PET tool : analyze linker barcode composition to estimate error rate
ChIA-PET: Chia-PET tool: trim linkers
ChIA-PET: BatMis 3.0: align to mm9 reference, only perfectly and uniquely aligned reads are retained
ChIA-PET: Chia-PET tool: remove PCR duplicate (merge tags mapping within +/-2bp into one PET)
ChIA-PET: Chia-PET tool: categorize reads as either a self-ligation PET (two ends of the same DNA fragment) or and inter-ligation PET (two ends from two different DNA fragments in the same chromatin complex)
ChIA-PET: Chia-PET tool : classify inter-ligation PETs as intrachromosomal or interchromosomal PETs
ChIA-PET: Chia-PET tool : intrachromosomal PET connections supported by at least 2 independent PETs are provided in bed12 format with the thick ends representing the PET clusters on either end of the connection
ChIA-PET: Chia-PET processing pipeline is described in greater detail in Li et al., 2010 (PMCID: PMC2872882)
Genome_build: mm9 (if mouse) or hg19 (if human)

Supplementary_files_format_and_content: ChIP-Seq: .wig files tag density in 100 nt windows divided by windowsize and library size in millions to obtain normalized read density (rpkm)
ChIP-Seq: .SuperEnhancers.bed files contain super-enhancer intervals called based on H3K27Ac ChIP-Seq
ChIP-Seq: .SNPs.bed files contain the positions of mutations
ChIP-Seq: the file k4me3.1kbmerge.pool.bed.gz contains the peak calls from pooled and downsampled RAMOS IP's used to identify hotspots
ChIP-Seq: the file me1.Nipbl.pos.bed.gz contains regulatory elements in RAMOS cells, called based on H3K4me1 and Nipbl ChIP-Seq
RNA-seq: .bigWig files contain extenden tag coverage in 100 nt windows divided by library size in millions to obtain normalized read coverage (rpm)
4C: *.tab files contain counts per fragment for DpnII fragments. Columns: chrom, start, end, counts_left_end, counts_right_end, norm_total_counts
ChIA-PET: .bed files show the significant connections that are supported by 2 or more independent PETs in a bed12 format

Submission date

Oct 06, 2014

Last update date

May 15, 2019

Contact name

Marei Dose

E-mail(s)

marei.dose@nih.gov

Organization name

National Institutes of Health

Street address

9000 Rockville Pk