NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1513959 Query DataSets for GSM1513959
Status Public on Oct 06, 2015
Title Flower PARE
Sample type SRA
 
Source name Open flower and flower bud
Organism Fragaria vesca
Characteristics tissue: Open flower and flower bud
plant stage: 6 months old
organ stage: mixed tissues
line: Yellow Wonder 5AF7
Growth protocol A seventh generation inbred line of Fragaria vesca, Yellow Wonder 5AF7 was grown in soil in growth chambers under 12 hr light as previously described (Hollender et al. 2012).
Extracted molecule total RNA
Extraction protocol For small RNA sequencing, total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Germantown, MD) with certain modifications. Specifically, the supernatant passing through Qiashedder spin column was precipitated in 1.5 volumes of ethanol and then centrifuge for 2 min at 12000 rpm. The pellet was dissolved in 50 µl of water, mixed with 500 µl Qiazol, and then 140 μl chloroform. After centrifuge, the supernatant was transferred to RNeasy mini spin column for further purification following the instruction from RNeasy Plant Mini Kit. The quality of total RNA was checked by Experion Automated Electrophoresis System (Bio-Rad, Hercules, CA).
10-20 µg total RNA per sample with RIN (RNA integrity number) above 7.8 were sent to the Weill Cornell Medical College’s Genomics Resources Core Facility for library preparation following the Illumina® TruSeq™ Small RNA Sample Preparation protocol. The libraries were sequenced on the Illumina Hiseq 2000 platform.
 
Library strategy ncRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2000
 
Data processing Fastx toolkit was used for data pre-processing. Original .fastq files were converted to .fasta files using fastq_to_fasta command (fastq_to_fasta -v -r -i INPUT_FILE.fastq -o OUTPUT_FILE.fasta -Q 33);
Adaptor was trimmed using the fastx_clipper (fastx_clipper -a "CTTGGCACCCGAGAATTCCA" -c -v -i INPUT_FILE.fasta -o OUTPUT_FILE -l 15);
Trimmed read file was collapsed into tag_count file using fastx_collapser (fastx_collapser -i INPUT_FILE -o OUTPUT_FILE);
Collapsed reads were mapped to reference genome by bowtie 1.0;
miRNA annotation, target identification and PHAS FBX annotation were conducted with customized pipelines.
Genome_build: fvesca_v1.0(scaffolds, http://www.rosaceae.org/species/fragaria/fragaria_vesca/genome_v1.0)
Supplementary_files_format_and_content: trimmed and collapsed read file in a tag_count formate. In the .txt file, each row has two columns. The first column is a small RNA sequence, and the second column the read count of the sequence.
 
Submission date Sep 26, 2014
Last update date May 15, 2019
Contact name Rui Xia
E-mail(s) rxia@scau.edu.cn
Organization name South China Agricultural University
Department Horticulture
Lab Xia
Street address 483 Wushan Rd, Tianhe
City Guangzhou
State/province Guangdong
ZIP/Postal code 510640
Country China
 
Platform ID GPL16761
Series (1)
GSE61798 Deep small RNA and degradome sequencing identifies new miRNAs-target pairs and novel PhasiRNAs in F-box regulatory networks in diploid strawberry
Relations
BioSample SAMN03081409
SRA SRX710728

Supplementary file Size Download File type/resource
GSM1513959_Flower_PARE_processed.txt.gz 133.4 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap