 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Oct 06, 2015 |
| Title |
10D seed |
| Sample type |
SRA |
| |
|
| Source name |
Seed
|
| Organism |
Fragaria vesca |
| Characteristics |
tissue: Seed
plant stage: 6 months old
organ stage: 10 days post anthesis
line: Yellow Wonder 5AF7
|
| Growth protocol |
A seventh generation inbred line of Fragaria vesca, Yellow Wonder 5AF7 was grown in soil in growth chambers under 12 hr light as previously described (Hollender et al. 2012).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
For small RNA sequencing, total RNA was extracted using the RNeasy Plant Mini Kit (Qiagen, Germantown, MD) with certain modifications. Specifically, the supernatant passing through Qiashedder spin column was precipitated in 1.5 volumes of ethanol and then centrifuge for 2 min at 12000 rpm. The pellet was dissolved in 50 µl of water, mixed with 500 µl Qiazol, and then 140 μl chloroform. After centrifuge, the supernatant was transferred to RNeasy mini spin column for further purification following the instruction from RNeasy Plant Mini Kit. The quality of total RNA was checked by Experion Automated Electrophoresis System (Bio-Rad, Hercules, CA).
10-20 µg total RNA per sample with RIN (RNA integrity number) above 7.8 were sent to the Weill Cornell Medical College’s Genomics Resources Core Facility for library preparation following the Illumina® TruSeq™ Small RNA Sample Preparation protocol. The libraries were sequenced on the Illumina Hiseq 2000 platform.
|
| |
|
| Library strategy |
ncRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Data processing |
Fastx toolkit was used for data pre-processing. Original .fastq files were converted to .fasta files using fastq_to_fasta command (fastq_to_fasta -v -r -i INPUT_FILE.fastq -o OUTPUT_FILE.fasta -Q 33);
Adaptor was trimmed using the fastx_clipper (fastx_clipper -a "CTTGGCACCCGAGAATTCCA" -c -v -i INPUT_FILE.fasta -o OUTPUT_FILE -l 15);
Trimmed read file was collapsed into tag_count file using fastx_collapser (fastx_collapser -i INPUT_FILE -o OUTPUT_FILE);
Collapsed reads were mapped to reference genome by bowtie 1.0;
miRNA annotation, target identification and PHAS FBX annotation were conducted with customized pipelines.
Genome_build: fvesca_v1.0(scaffolds, http://www.rosaceae.org/species/fragaria/fragaria_vesca/genome_v1.0)
Supplementary_files_format_and_content: trimmed and collapsed read file in a tag_count formate. In the .txt file, each row has two columns. The first column is a small RNA sequence, and the second column the read count of the sequence.
|
| |
|
| Submission date |
Sep 26, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Rui Xia |
| E-mail(s) |
rxia@scau.edu.cn
|
| Organization name |
South China Agricultural University
|
| Department |
Horticulture
|
| Lab |
Xia
|
| Street address |
483 Wushan Rd, Tianhe
|
| City |
Guangzhou |
| State/province |
Guangdong |
| ZIP/Postal code |
510640 |
| Country |
China |
| |
|
| Platform ID |
GPL16761 |
| Series (1) |
| GSE61798 |
Deep small RNA and degradome sequencing identifies new miRNAs-target pairs and novel PhasiRNAs in F-box regulatory networks in diploid strawberry |
|
| Relations |
| BioSample |
SAMN03081403 |
| SRA |
SRX710722 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1513953_10D_seed_processed.txt.gz |
38.1 Mb |
(ftp)(http) |
TXT |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
