NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1467599 Query DataSets for GSM1467599
Status Public on Mar 20, 2015
Title d6PGCLC_H3K27ac_1
Sample type SRA
 
Source name PGCLC 6days
Organism Mus musculus
Characteristics strain: C57BL/6
chip antibody: anti H3K27ac, MsIgG, CMA309
genotype/variation: Blimp1-mVenus reporter (BV),Prdm14-mVenus reporter (PV)
Treatment protocol d2 and d6 PGCLCs of the BVSC line were purified with Fluorescence-activated cell sorter (FACS) (ARIA III; BD Biosciences) by fluorescence of BV. For the EGFP-BLIMP1 knock-in line, d2 PGCLCs were purified with FACS using anti-Kit antibody and d6 PGCLCs using anti-SSEA1 and anti-Integrin b3 antibodies.
Growth protocol BVSC and EGFP-Blimp1 knock-in ESC lines were induced into EpiLCs as described for 48 hrs (BVSC) or 36 hrs (EGFP-Blimp1 knock-in). The EpiLCs were then cultured under a floating condition by plating 2-3×103 cells per well of lipidure-coated U-bottom 96-well plate (Thermo Scientific) in the GK15 medium containing LIF (1000 U/mL) for induction of d2 LIF aggregate (d2 LIF Ag), LIF and BMP4 (500 ng/mL) for d2 PGCLCs, and LIF, BMP4, BMP8a (500ng /mL), SCF (100 ng/mL), and EGF (50 ng/mL) for d6 PGCLCs, respectively.
Extracted molecule genomic DNA
Extraction protocol Cells were suspended in 1 mL of phosphate buffered saline (PBS) and fixed by adding 27 mL of 36.5% formalin (Sigma) for 10 min at room temperature. Fixation was terminated by adding 110 mL of 1.5 mM glycine. The fixed cells were washed twice in PBS containing 0.1% bovine serum albmin (BSA), and were lysed in 400 mL SDS-lysis buffer [50 mM Tris-HCl (pH 8.0) containing 1% SDS, 10 uM EDTA, and 1 mM PMSF] on ice for 10 min. Chromatins were then solubilized using Bioruptor UCD250 with ice-chilled water, with 15 cycles of 30 sec sonication at the high power and 60 sec interval. The sonication products were centrifuged at 16,000 g for 5 min. The supernatants were diluted in 1 mL ChIP dilution buffer [16.7 mM Tris-HCl (pH 8.0), 0.01% SDS, 1.1% Triton X100, 1.2 mM EDTA, 167 mM NaCl, 1 mM SDS, 200 mg/mL tRNA (Roche)], and were divided into 0.1 mL as input DNA and 1.3 mL as ChIP samples. The ChIP samples were mixed with the Dynabeads-antibody complexes and rotated at 4 ºC overnight. The ChIP-ed Dynabeads were recovered using the DynaMag-2 magnet (Life Technologies), and washed with 200 mL of low salt buffer [20mM Tris-Cl (pH 8.0), containing 0.1% SDS, 1% Triton X100, 2 mM EDTA, and 150 mM NaCl], high salt buffer [20mM Tris-Cl (pH 8.0), containing 0.1% SDS, 1% Triton X100, 2 mM EDTA, and 500 mM NaCl], RIPA buffer [10mM Tris Cl (pH8.0), containing 1% Sodium deoxycholate, 1% NP40, 250 mM LiCl, and 1 mM EDTA], and TE buffer [10 mM Tris Cl (pH8.0), containing 1 mM EDTA]. The ChIP-ed Dynabeads were then incubated in new tubes containing 50 mL of Elution buffer (0.1 mM NaHCO3, 1% SDS, 10 mM DTT, and 0.06 mM tRNA) for 15 min at room temperature. The supernatants were collected using DynaMag-2, and were reverse-crosslinked by adding 8 mL of 2.5 M NaCl and incubating at 65 ºC overnight. Then, 2 mL of 0.5 M EDTA and 4 mL of 0.645 mg/mL proteinase K solution were added to reaction mixture, and further incubated at 45 ºC for 1 hr. The ChIP-ed DNAs were then purified with Qiaquick PCR purification columns, using the buffer EB supplemented with 4 ng/mL tRNA (Qiagen).
The ChIP-ed and Input DNAs were sheared to an average size of about 150 bp by ultra-sonication (Covaris, Woburn, MA). ChIP-ed DNAs obtained from 1×106 cells were then subjected to the procedures for SOLiD Fragment Library Preparation (Life Technologies) according to the manufacture’s instruction except for the ligation reaction that was performed overnight. The libraries were amplified with 11-13 cycles of PCR for H3K4me3 and H3K27ac or 8 cycles for H3K9me2 and H3K27me3.
ChIP-ed DNA for histone modifications from 1×105 cells were subjected to the procedures for SOLiD Fragment Library Preparation with a modification where the size fractionation step using AMPure XP beads (Agencourt) was omitted and ligation reaction was performed overnight. The libraries were amplified with 12-16 cycles of PCR for H3K27ac or 8 cycles for H3K9me2 and H3K27me3.
We developed a new method to prepare and precisely amplify libraries of ChIPed DNA from a small number of cells, and applied this method to H3K4me3 from 1 x 105 cells and transcription factors from 3×105 ~ 1×106 cells. A modified adaptor for SOLiD library was prepared by annealing 50 mM each of P1-T Adaptor/F (CCACTACGCCTCCGCTTTCCTCTCTATGGGCAGTCGGTGAT) and Barcode-Internal+12mer/R (TCACCGACTGCCACGCCTTGGCCGTACAGCAGCCTCTTACACAGAG, with Phosphorylated 5'-end) in 1×Linker buffer [50 mM Tris-HCl (pH 8.0) containing 100 mM NaCl and 1 mM EDTA] with a step-wise cooling procedure (95 ºC, 70 ºC, 50 ºC, 40 ºC and 25 ºC for 15 min, respectively). The sheared DNAs were end-repaired using End-It DNA End-Repair Kit (Epicentre) in a 120 mL scale according to the manufacture’s instruction, and purified using MinElute PCR purification kit (Qiagen) with 540 mL of binding buffer PB3 (5.6 M Gu HCl, 33.3% isopropanol) supplemented with 10 ng/mL tRNA and 10 mL of elution buffer EB (Qiagen) with 4 ng/mL tRNA. The end-repaired DNAs were incubated in 20 mL of dA tailing mixture [0.2 mM dATP (GE Healthcare), 1×High Yield buffer (Greiner), 4 ng/mL tRNA 2.5 unit of Taq DNA polymerase (Greiner)], for 10 min at 70 ºC, and purified using MinElute PCR purification kit with buffers PB (Qiagen) and EB (11 mL) supplemented with tRNA. The dA-tailed DNAs were incubated in 15 mL ligation mixture [1×DNA Ligase Reaction Buffer (Life Technologies), 0.1 mM the modified adaptor, and 2.5 unit ExpressLink T4 DNA Ligase (Life Technologies)] at 16 ºC for more than 22 hr. The adaptor-ligated DNAs were then amplified using the Platinum Taq DNA Polymerase in a 50 mL reaction scale (Life Technologies) with 1 mM each of Library PCR primer 1 (Life Technologies) and Library PCR primer Barcode001+Internal adaptor (CTCTGTGTAAGAGGCTGCTGTACGGCC). PCR was performed with 8 cycles for ChIP-ed DNAs of H3K4me3 and with 10 cycles for those of EGFP-BLIMP1. PCR products were purified using 50 mL AMPure XP beads supplemented with 3.33 mL of 25% PEG8000 and 13.7 mL of 2.5 M NaCl, and eluted in 30 mL of buffer EB supplemented with tRNA. The PCR products were then subjected to another 5-cycle PCR using 1 mM each of Library PCR Primer 1 and P2-Barcode-N-Internal primer [CTGCCCCGGGTTCCTCATTCTCT (N10) CTGCTGTACGGCCAAGGCGT, where N10 corresponds to SOLiD barcode sequences other than barcode 1; e.g., AGGGAGTGGT for barcode 2], and purified twice with AMPure XP beads supplemented with PEG8000 and NaCl.
 
Library strategy ChIP-Seq
Library source genomic
Library selection ChIP
Instrument model AB 5500xl Genetic Analyzer
 
Data processing Read data were mapped on mouse mm9 genome by bowtie v0.12.9 with "-n 3 -m 1" option.
Mapped reads were sorted and format converted using samtools v0.1.18 and picard-tools v1.85.
Tdf files are made using igvtools v2.3.5.
Peak calling for EGFP-BLIMP1, T, H3K4me3, and H3K27ac were performed using MACS v1.4.2 with default setting.
To enable comparison of peaks in different samples, we scanned all peaks throughout the genome, and considered peaks detected in proximities (within 1 Kb) as a single peak.
Genome_build: mm9
Supplementary_files_format_and_content: Tdf files are made using igvtools v2.3.5 with "-w 25 -e 250" setting
Supplementary_files_format_and_content: Bed files of H3K27me3 and H3K9me2 were made by counting fpkm in 2kb-bin at every 1kb on the genome. Fpkm values were divided by that of input value and subsequently normalized by QPCR data.
Supplementary_files_format_and_content: Bed files for H3K27ac_all_peaks and H3K4me3_all_peaks were made as follows: we scanned all peaks in all samples throughout the genome, and considered peaks detected in proximities (within 1 Kb) as a single peak to be able to compare read intensity among samples.
 
Submission date Aug 07, 2014
Last update date May 15, 2019
Contact name Yukihiro Yabuta
E-mail(s) yabyab@anat2.med.kyoto-u.ac.jp
Organization name Kyoto University, Graduate school of medicine
Department Anatomy and Cell Biology
Street address Yoshida-Konoe-cho, Sakyo-ku
City Kyoto
State/province Kyoto
ZIP/Postal code 606-8501
Country Japan
 
Platform ID GPL15907
Series (1)
GSE60204 Quantitative Dynamics of Chromatin Remodeling during Germ Cell Specification from Mouse Embryonic Stem Cells
Relations
BioSample SAMN02979067
SRA SRX672388

Supplementary file Size Download File type/resource
GSM1467599_d6PGCLC_H3K27ac_1.tdf 293.6 Mb (ftp)(http) TDF
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file
Processed data are available on Series record

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap