NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1372943 Query DataSets for GSM1372943
Status Public on Apr 01, 2015
Title MI-45_Pso-NL_all
Sample type SRA
 
Source name human whole skin (epidermis + dermis)
Organism Homo sapiens
Characteristics tissue: Whole tissue extract
indication: Non-Lesional Psoriatic Skin
Extracted molecule total RNA
Extraction protocol miRNEasy Micro Kit (Qiagen)
A barcoded cDNA library for small RNA sequencing was prepared according to Hafner M. et al., Methods 44; 3-12, 2008 and Hafner M et al., Methods 58; 164-170, 2012.
 
Library strategy miRNA-Seq
Library source transcriptomic
Library selection size fractionation
Instrument model Illumina HiSeq 2500
 
Description lane: Marianne_A_NoIndex_L001_R1_001.fastq.gz
barcode + 3' adaptor: TATCATCGTATGCCGTCTTCTGCTTG
Data processing Samples are demultiplexed by assigning by 5 nt barcodes and adapters and barcodes are removed from fastq files converted to fasta using perl scripts.
Fasta file is collapsed into a non-redundant fasta file in which the read count is contained within the read header and mapped against an in-house ncRNA reference derived from GenBank and an internally curated set of miRNAs. BWA v0.5.9 used, with parameters aln -n 2 -t 16 -i 0 -d 0 to align reads to the reference.
Multi-mapping reads are first assigned to hits with the lowest number of errors, then the count is split equally between the number of locations mapped.
Genome_build: hg19
Supplementary_files_format_and_content: tab separated file summarizing reads attributed to an internal reference of ncRNAs. First column is the read, second is the count, last column a comma-separated list of mapped annotation
 
Submission date Apr 23, 2014
Last update date May 15, 2019
Contact name Miguel Brown
E-mail(s) miguel.a.brown@gmail.com
Organization name The Rockefeller University
Street address 1230 York Ave Box 186
City New York
State/province New York
ZIP/Postal code 10065
Country USA
 
Platform ID GPL16791
Series (1)
GSE57012 Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that mirror the systemic psoriatic miRNome
Relations
BioSample SAMN02732357
SRA SRX525014

Supplementary file Size Download File type/resource
GSM1372943_MI-45_Pso-NL_all_geo.txt.gz 3.7 Mb (ftp)(http) TXT
SRA Run SelectorHelp
Raw data are available in SRA
Processed data provided as supplementary file

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap