|
| Status |
Public on Apr 01, 2015 |
| Title |
SD_Pso-NL_all |
| Sample type |
SRA |
| |
|
| Source name |
human whole skin (epidermis + dermis)
|
| Organism |
Homo sapiens |
| Characteristics |
tissue: Whole tissue extract
indication: Non-Lesional Psoriatic Skin
|
| Extracted molecule |
total RNA |
| Extraction protocol |
miRNEasy Micro Kit (Qiagen)
A barcoded cDNA library for small RNA sequencing was prepared according to Hafner M. et al., Methods 44; 3-12, 2008 and Hafner M et al., Methods 58; 164-170, 2012.
|
| |
|
| Library strategy |
miRNA-Seq |
| Library source |
transcriptomic |
| Library selection |
size fractionation |
| Instrument model |
Illumina HiSeq 2500 |
| |
|
| Description |
lane: Marianne_A_NoIndex_L001_R1_001.fastq.gz
barcode + 3' adaptor: TAGAGTCGTATGCCGTCTTCTGCTTG
|
| Data processing |
Samples are demultiplexed by assigning by 5 nt barcodes and adapters and barcodes are removed from fastq files converted to fasta using perl scripts.
Fasta file is collapsed into a non-redundant fasta file in which the read count is contained within the read header and mapped against an in-house ncRNA reference derived from GenBank and an internally curated set of miRNAs. BWA v0.5.9 used, with parameters aln -n 2 -t 16 -i 0 -d 0 to align reads to the reference.
Multi-mapping reads are first assigned to hits with the lowest number of errors, then the count is split equally between the number of locations mapped.
Genome_build: hg19
Supplementary_files_format_and_content: tab separated file summarizing reads attributed to an internal reference of ncRNAs. First column is the read, second is the count, last column a comma-separated list of mapped annotation
|
| |
|
| Submission date |
Apr 23, 2014 |
| Last update date |
May 15, 2019 |
| Contact name |
Miguel Brown |
| E-mail(s) |
miguel.a.brown@gmail.com
|
| Organization name |
The Rockefeller University
|
| Street address |
1230 York Ave Box 186
|
| City |
New York |
| State/province |
New York |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platform ID |
GPL16791 |
| Series (1) |
| GSE57012 |
Laser capture microdissection followed by next-generation sequencing identifies disease-related microRNAs in psoriatic skin that mirror the systemic psoriatic miRNome |
|
| Relations |
| BioSample |
SAMN02732354 |
| SRA |
SRX525012 |
