 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 14, 2014 |
| Title |
Gro-seq-siCTL-re1-HEK293T |
| Sample type |
SRA |
| |
|
| Source name |
HEK293T cell
|
| Organism |
Homo sapiens |
| Characteristics |
cell line: Human Embryonic Kidney 293 cells
sirna transfection: siCTL
|
| Treatment protocol |
Cells were subjected to two rounds of siRNAs transfection in 3 days, followed by nuclei isolation.
|
| Growth protocol |
HEK293Tcells were cultured in DMEM medium supplemented with 10% FBS.
|
| Extracted molecule |
total RNA |
| Extraction protocol |
cells were washed 3 times with cold 1X phosphate buffered saline (PBS) buffer and then incubated in swelling buffer (10mM Tris-Cl pH7.5, 2mM MgCl2, 3mM CaCl2) for 5min on ice and harvested. Cells were first re-suspended and lysed in lysis buffer (swelling buffer with 0.5% IGEPAL and 10% glycerol). The resultant nuclei were washed once again with 10 ml lysis buffer and then re-suspended in 100ml of freezing buffer (50mM Tris-Cl pH 8.3, 40% glycerol, 5mM MgCl2, 0.1mM EDTA).
For run-on assay, resuspended nuclei were mixed with an equal volume of reaction buffer (10mM Tris-Cl pH 8.0, 5mM MgCl2, 1mM DTT, 300mM KCl, 20 units of SUPERase In, 1% sarkosyl, 500mM ATP, GTP, and Br-UTP, 2mM CTP) and incubated for 5 min at 30°C. The nuclear-run-on RNA (NRO-RNA) was then extracted with TRIzol LS reagent (Invitogen) following manufacturer’s instructions. NRO-RNA was then subjected to base hydrolysis on ice for 40 min and followed by treatment with DNase I and antarctic phosphatase. To purify the Br-UTP labeled nascent RNA, the NRO-RNA was immunoprecipitated with an anti-BrdU agarose beads (Santa Cruz Biotech) in binding buffer (0.5XSSPE, 1mM EDTA, 0.05% tween-20) for 1h at 4°C while rotating. To repair the end, the immunoprecipitated BrU-RNA was re-suspended in 50mL reaction (43mL DEPC water, 5.2mL T4 PNK buffer, 1mL SUPERase In and 1mL T4 PNK (New England BioLabs)) and incubated at 37°C for 1h. RNA was then extracted, precipitated using acidic phenol-chloroform (Ambion) and subjected to poly-A tailing reaction by using poly-A polymerase (New England BioLabs) for 30 min at 37°C. Subsequently, reverse transcription was performed using oNTI223- primers (5’- pGATCGTCGGACTGTAGAACTCT; CAAGCAGAAGACGGCATACGATTTTTTTTTTTTTTTTTTTTVN-3’) where the p indicates 5’ phosphorylation, ‘;’ indicates the abasic dSpacer furan and VN indicates degenerate nucleotides. Specifically, tailed RNA (8.0mL) was subjected to reverse transcription using superscript III (Invitrogen), after which the cDNA products were separated on a 10% polyacrylamide TBE-urea gel. The extended first-strand product (100-500bp) was excised and recovered by gel extraction. After that, the first-strand cDNA was circularized by CircLigase (Epicentre) and re-linearized by Ape1 (New England BioLabs). Re-linearized single strand cDNA (sscDNA) was separated in a 10% polyacrylamide TBE gel as described above and the product of needed size was excised (~170-400bp) for gel extraction. Finally, sscDNA template was amplified by PCR using the Phusion High-Fidelity enzyme (NEB) according to the manufacturer’s instructions. Primers oNTI200 (5’-CAAGCAGAAGACGGCATA-3’) and oNTI201 (5’- AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGACG-3’) were used to generate DNAs for deep sequencing.
|
| |
|
| Library strategy |
RNA-Seq |
| Library source |
transcriptomic |
| Library selection |
cDNA |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Description |
Gro-seq in HEK293T cells transfected with control siRNA
Nascent RNA sequencing
|
| Data processing |
Basecalls performed using CASAVA version 1.4
Gro-seq reads were aligned to the hg18 genome assembly using Bowtie version 2.0.1.
The bigwig files were generated by using Homer v3.9, which the total tags are normalized to 1.00e+07.
Genome_build: hg18
Supplementary_files_format_and_content: bigwig files report normalized total tags
|
| |
|
| Submission date |
Oct 24, 2013 |
| Last update date |
Aug 26, 2014 |
| Contact name |
Qi Ma |
| E-mail(s) |
q1ma@ucsd.edu
|
| Organization name |
UCSD
|
| Street address |
9500 Gilman Dr,
|
| City |
San Diego |
| ZIP/Postal code |
92093 |
| Country |
USA |
| |
|
| Platform ID |
GPL9115 |
| Series (1) |
| GSE51633 |
Brd4 and JMJD6-associated Anti-pause Enhancers in Regulation of Transcriptional Pause Release |
|
| Relations |
| BioSample |
SAMN02383459 |
| Named Annotation |
GSM1249869_Groseq-siCTL-1-re1-HEK293T-minusstrand.bigWig |
| Named Annotation |
GSM1249869_Groseq-siCTL-1-re1-HEK293T-plusstrand.bigWig |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1249869_Groseq-siCTL-1-re1-HEK293T-minusstrand.bigWig |
44.8 Mb |
(ftp)(http) |
BIGWIG |
| GSM1249869_Groseq-siCTL-1-re1-HEK293T-plusstrand.bigWig |
47.1 Mb |
(ftp)(http) |
BIGWIG |
| Raw data provided as supplementary file |
| Processed data provided as supplementary file |
|
|
|
|
 |
