 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 11, 2014 |
| Title |
MOV10_D645N_PARCLIP |
| Sample type |
SRA |
| |
|
| Source name |
HEK293 cell culture
|
| Organism |
Homo sapiens |
| Characteristics |
antibody: FLAG
culture medium: DMEM
expression: MOV10 D645N
|
| Treatment protocol |
Cells were incubated with 100 μM 4SU (ChemGenes) nucleoside analog for 14 hrs and UV crosslinked as previously described (Hafner et al., 2010), frozen in liquid nitrogen and stored at -80 oC. Cells were lysed in 3 times the cell pellet volume of high salt NP-40 lysis buffer (50 mM Tris pH = 7.2, 500 mM NaCl, 1% (v/v) NP-40, 1 mM DTT, complete EDTA-free protease inhibitor cocktail (Roche)), incubated 30 min on ice followed by 45 sec sonication (80 % amplitude). UPF1 cell pellets were lysed in 3 times the cell pellet volume of low salt NP-40 lysis buffer (50 mM HEPES-KOH pH = 7.5, 150 mM KCl, EDTA-NaOH pH = 8.0, 0.5% (v/v) NP-40, 1 mM DTT, complete EDTA-free protease inhibitor cocktail (Roche)), incubated 20 min on ice. IP was performed as previously described (Hafner et al., 2010) with the following modifications: (1) The second ribonuclease digestion was performed with a final concentration of 20 U/μL RNaseT1 (Fermentas) for MOV10 WT and MOV10 K530A IPs. The second ribonuclease digestion was performed with a final concentration of 10 U/μL RNaseT1 for MOV10 D645N and UPF1 IPs (2) Proteinase K (Roche) digestion was performed with a final concentration of 2 mg/mL for 1 hr at 55 oC.
|
| Growth protocol |
Flp-In T-REx HEK293 cells expressing FLAG/HA-tagged MOV10 WT, MOV10 K530A and MOV10 D645N were grown in high glucose SILAC DMEM (PAA) supplemented with 10 % (v/v) dialyzed fetal bovine serum (Sigma-Aldrich), 4 mM Glutamine (PAA), 0.05 mg/mL Lysine (Sigma-Aldrich) and 0.03 mg/mL Arginine (Sigma-Aldrich). Flp-In T-REx HEK293 cells expressing FLAG/HA-tagged UPF1 were grown in high glucose DMEM media (Invitrogen) supplemented with 10 % (v/v) fetal bovine serum (Sigma-Aldrich), 1 % (v/v) 2 mM L-glutamine (Invitrogen), 1 % (v/v) 10,000 U/mL penicillin and 10,000 μg/mL streptomycin (Invitrogen).
|
| Extracted molecule |
total RNA |
| Extraction protocol |
cDNA libraries were generated as described (Hafner et al., 2010), amplified using the Phusion High-Fidelity DNA polymerase (Finnzymes) and gel purified using the QIAquick gel extraction kit (Qiagen).
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
binding sites
5' adapter: GTTCAGAGTTCTACAGTCCGACGATC, 3' adapter: TCTCCATTCGTATGCCGTCTTCTGCTTG
5' adapter: GTTCAGAGTTCTACAGTCCGACGATC, 3' adapter: TCTCGTATCGTATGCCGTCTTCTGCTTG
|
| Data processing |
Adapters were removed with FLEXBAR (the flexible adapter remover: http://sourceforge.net/projects/flexbar/) aligned to hg18 using BWA. Unique alignments were converted to a pileup and read clusters scored for characteristic conversions and read variability with a custom script. After stringent-false positive filtering (using antisense clusters as a decoy database) remaining clusters were output as bed files. See Lebedeva et al. 2011 Mol Cell 43, 340–352 for details.
|
| |
|
| Submission date |
Jun 24, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Markus Landthaler |
| E-mail(s) |
markus.landthaler@mdc-berlin.de
|
| Phone |
+49-30-9406-3026
|
| Organization name |
Max-Delbrück-Center for Molecular Medicine
|
| Department |
Berlin Institute for Medical Systems Biology
|
| Street address |
Robert-Rössle-Straße 10
|
| City |
Berlin |
| ZIP/Postal code |
13125 |
| Country |
Germany |
| |
|
| Platform ID |
GPL11154 |
| Series (2) |
| GSE48245 |
MOV10 is a 5' to 3' RNA Helicase Contributing to UPF1 mRNA Target Degradation by Translocation Along 3' UTRs (PAR-CLIP) |
| GSE56751 |
MOV10 Is a 5' to 3' RNA Helicase Contributing to UPF1 mRNA Target Degradation by Translocation along 3'UTRs |
|
| Relations |
| BioSample |
SAMN02212566 |
| SRA |
SRX314719 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1173265_allTC_4su_MOV10_D645N.bed.gz |
2.7 Mb |
(ftp)(http) |
BED |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
