NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Sample GSM1149394 Query DataSets for GSM1149394
Status Public on Dec 20, 2013
Title RBM6 sh3
Sample type RNA
 
Source name HeLa cell, RBM6 kd
Organism Homo sapiens
Characteristics shRNA sequence: CCGGGCCTATCTGGAAAGGAGAGAACTCGAGTTCTCTCCTTTCCAGATAGGCTTTTTTG and CCGGCAAATGTAGAGGAGCATTCTTCTCGAGAAGAATGCTCCTCTACATTTGTTTTTTG
cell line: HeLa
treatment: RBM6 kd
Treatment protocol Knockdowns of RBM5, RBM6 or RBM10 in Hela cells were performed by lentiviral infections using the pLKO.1 carrier vector for specific shRNA (Sigma Aldrich).
Growth protocol HeLa cell lines were cultured in Dulbecco’s modified Eagle’s medium (DMEM) supplemented with 10% fetal bovine serum (FBS) and penicillin/streptomycin.
Extracted molecule total RNA
Extraction protocol RNA from three biological replicates of sh-RBM infected HeLa cells was purified using Rneasy mini kit (Qiagen).
Label biotin
Label protocol Samples were enzymatically fragmented and biotinylated using the WT Terminal Labeling Kit (Affymetrix)
 
Hybridization protocol Samples were hybridized using Affymetrix hybridization kit materials. Heat cocktails at 99° for 5 minutes, then 42° for 5 minutes centrifuge at max speed for 1 minute (N.B. this deviates from Affy SOP). Transfer 200μl of hyb solution to each array, then tape holes and parafilm. Hybridize 16 hours at 45° at 60rpm. Fluidics washing is FS450_0001.
Scan protocol Affymetrix Gene ChIP Scanner 3000 7G
Description Additional analysis data in VALCARCEL_RBM6-sh_vs_plko.xls
Data processing Affymetrix HJAY dataset analysis was performed by GenoSplice technology (www.genosplice.com). Raw data was processed using Expression Console to get the RMA intensities values of Affymetrix HJAY probesets. Additional analysis included the follwing. Data were normalized using quantile normalization. Background corrections were made with antigenomic probes and probes were selected according to their %GC, cross-hybridization status and potential overlap with repeat region as previously described [PMID:23321315, PMID:23284676]. Only probes targeting exons and exon-exon junctions annotated from FAST DB® transcripts (release fastdb_2012_2) were selected [PMID:16052034,PMID:17547750]. Only probes with a DABG Pvalue ≤ 0.05 in at least half of the arrays were considered for statistical analysis [PMID:23321315, PMID:23284676]. Only genes expressed in at least one compared condition were analyzed. To be considered to be expressed, the DABG Pvalue had to be ≤ 0.05 for at least half of the gene probes. We performed an unpaired Student’s t-test to compare gene intensities between two experimental conditions. Genes were considered significantly regulated when fold-change was ≥1.5 and Pvalue 0.05 (unadjusted P-value). Analysis at the splicing level was first performed taking into account only exon probes (EXON analysis) in order to potentially detect new alternative events that could be differentially regulated (i.e., without taking into account exon-exon junction probes). Analysis at the splicing level was also performed by taking into account exon-exon junction probes (SPLICING PATTERN analysis) using the FAST DB® splicing patterns annotation (i.e., for each gene, all possible splicing patterns were defined and analyzed. All types of alternative events can be analyzed: Alternative first exons, alternative terminal exons, cassette exon, mutually exclusive exons, alternative 5’ donor splice site, alternative 3’ acceptor splice sites and intron retention). EXON and SPLICING PATTERN analyses were performed using unpaired Student's t-test on the splicing-index as previously described [PMID:23321315, PMID:23284676]. Results were considered statistically significant for unadjusted P-values ≤ 0.05 and fold-changes ≥ 2.0 for EXON analysis and for unadjusted P-values ≤ 0.05 and fold-changes ≥ 1.5 for SPLICING PATTERN analysis. Gene Ontology (GO), KEGG and REACTOME analyses of differentially regulated genes were performed using DAVID [PMID:19131956].
 
Submission date May 28, 2013
Last update date Dec 21, 2013
Contact name Endre Sebestyén
Organization name Semmelweis University
Department 1st Department of Pathology and Experimental Cancer Research
Street address Üllői út 26.
City Budapest
ZIP/Postal code 1085
Country Hungary
 
Platform ID GPL15106
Series (1)
GSE47431 Regulation of NUMB alternative splicing by RBM5, RBM6 and RBM10 controls cancer cell proliferation

Data table header descriptions
ID_REF
VALUE RMA intensities values of Affymetrix HJAY probesets using Expression Console

Data table
ID_REF VALUE
1 10.35808
2 12.4984
3 13.19234
4 13.50311
5 12.26326
6 10.77565
7 9.862125
8 12.27283
9 11.88784
10 11.31381
11 11.28834
12 10.51758
13 11.61301
14 11.33604
15 11.04745
16 11.13811
17 10.57278
18 9.65391
19 11.93641
20 11.312

Total number of rows: 573410

Table truncated, full table size 8788 Kbytes.




Supplementary file Size Download File type/resource
GSM1149394_VALCARCEL_RBM6_sh3.CEL.gz 25.0 Mb (ftp)(http) CEL
Processed data included within Sample table

| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap