 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 17, 2013 |
| Title |
1hr DMSO treated HCT116 |
| Sample type |
SRA |
| |
|
| Source name |
colorectal cancer cells
|
| Organism |
Homo sapiens |
| Characteristics |
treatment: DMSO
cell line: HCT116
|
| Treatment protocol |
20 ml McCoys 5A medium supplemented with 10% fetal calf serum with 20 ul DMSO for 1 hour
|
| Growth protocol |
Hct116 cells were plated in McCoys 5A medium supplemented with 10% fetal calf serum 24hrs prior to treatment as indicated
|
| Extracted molecule |
total RNA |
| Extraction protocol |
GRO-seq library preparation and Illumina sequencing: Nuclear run-on and sequencing library preparation were performed essentially as described in Wang et al. (2011) Reprogramming transcription by distinct classes of enhancers functionally defined by eRNA. Nature 474, 390–394. for a total of three biological replicates. HCT116 cells were plated at a concentration of 1 x 107 on 15 cm plates in McCoy’s 5A medium and allowed to grow 24 hr before harvesting. Cells were washed three times with ice cold PBS and then treated with 10 ml per plate of ice-cold lysis buffer (10 mM Tris-Cl pH 7.4, 2 mM MgCl2, 3 mM CaCl2, 0.5% IGEPAL, 10% glycerol, 1 mM DTT, 1x Protease Inhibitor Cocktail (Roche 11 836 153 001), 4U / ml SUPERase-In RNase inhibitor) and collected by scraping. Cells were then centrifuged at 1000x g for 7 min at 4ºC and re-suspended in 1.5 ml lysis buffer by pipetting 20-30 times. A further 8.5 ml of lysis buffer was added and the suspension centrifuged at 1000x g for 7 min at 4ºC to collect nuclei. Nuclei were washed in 1 ml lysis buffer and re-suspended in 500 µl freezing buffer (50 mM Tris pH 8.3, 40% glycerol, 5 mM MgCl2, 0.1 mM EDTA, 4U / ml SUPERase-In), pelleted again (2000x g for 2 min at 4ºC), and finally re-suspended in 100 µl freezing buffer. To determine concentration, nuclei were counted and diluted with freezing buffer before 100 µl aliquots of 5 x 106 nuclei were snap-frozen in liquid Nitrogen and stored at -80ºC. Nuclear run-on was performed by adding 100 µl aliquots of nuclei to 100 µl reaction buffer (10 mM Tris pH 8.0, 5 mM MgCl2, 1 mM DTT, 300 mM KCl, 20 units SUPERase-In, 1% Sarkosyl, 500 μM each of ATP, GTP, CTP and Bromo-UTP) and incubating for 5 min at 30 °C. Reactions were stopped by adding 1 ml Trizol to the reaction and vortexing to homogeneity. Samples were split in half and another 500 µl Trizol added to each half. To isolate RNA, 220 µl chloroform was added to each half sample and samples were centrifuged at 12,000x g for 15 min. The aqueous phase was transferred to a new tube and 22.5 µl 5M NaCl added. Samples were extracted twice with phenol-chloroform (pH 4.5), then once with chloroform. Finally, RNA was co-precipitated with 1 µl glyco-blue (Ambion) by adding three volumes of ice cold ethanol and incubating at -20°C for at least 20 min. Pellets were washed with 70% ethanol, air-dried 2 min and dissolved in 20 µl DEPC-treated water. RNA was base-hydrolyzed with 5 µl 1M NaOH on ice for 30 min (creating an average fragment size of ~150 bp). Reactions were neutralized with 25 µl 1M Tris-Cl pH6.8 and passed through a BioRad P-30 column as per the manufacturer’s protocol. Samples were then DNAse treated in 1x RQ1 DNase buffer with 3 µl RQ1 DNaseI (Promega) at 37ºC for 10 min and again passed through BioRad P-30 columns. To remove 5’ phosphates, 8.5 μl 10x phosphatase buffer, 5 μl of antarctic phosphatase (New England Biolabs) and 1 μl of SUPERase-In was added to each RNA sample followed by incubation for 1 hr at 37 °C. Samples were passed through a third BioRad P-30 column and the final volume of each RNA solution was brought up to 100 µl with DEPC-treated H2O and 1 µl 500 mM EDTA. To prepare beads for immunopurification of Br-UTP-labeled nascent RNA, 60 μl anti-BrdU agarose beads (Santa Cruz Biotech) per sample were washed in 500 μl blocking buffer (0.5x SSPE, 1 mM EDTA, 0.05% Tween-20, 0.1% PVP, and 1 mg/ml BSA), incubated in 500 μl blocking buffer for 1 hr at 4 °C, washed twice for 5 min each in binding buffer (0.5x SSPE, 1 mM EDTA, 0.05% Tween-20) and finally re-suspended in 400 µl binding buffer. Total RNA samples (100 µl) were heated to 65 °C for 5 min, chilled on ice and then incubated with blocked anti-BrdU beads in 400 µl binding buffer for 1 hr at room temperature with rocking. Beads were washed (3 min with rocking) once in binding buffer, once in low salt buffer (0.2x SSPE, 1 mM EDTA, 0.05% Tween-20), once in high salt buffer (0.5% SSPE, 1 mM EDTA, 0.05% Tween-20, 150 mM NaCl) and twice in TET buffer (TE pH 7.4, 0.05% Tween-20). Nascent RNA was eluted four times with 125 μl elution buffer (5 mM Tris pH 7.5, 300 mM NaCl, 20 mM DTT, 1 mM EDTA, 0.1% SDS). Pooled RNA elutions were then extracted once with phenol/chloroform (pH 4.5), once with chloroform and precipitated by the addition of 1 µl glyco-blue, 300 mM NaCl, three volumes of ethanol at 20ºC for at least 20 min. The precipitated RNA was washed with 70% ethanol and re-suspended in 50 μl PNK reactions (45 μl DEPC-treated water, 5.2 μl T4 PNK buffer, 1 μl SUPERase-In, 1 μl T4 PNK, New England Biolabs), incubated at 37ºC for 1 hr and RNA was recovered as above. Poly-A tails were added to PNK-treated RNA fragments (in 5 μl water) by adding 0.8 μl poly-A polymerase buffer, 0.8 μl 10 mM ATP, 0.5 μl SUPERase-In and 0.75 μl poly-A polymerase (New England Biolabs) and incubating 10 min at 37ºC. Reactions were stopped by adding by adding 8 μl 500 mM EDTA, 12 μl 5M NaCl and 184 μl DEPC-water. The RNA was then recovered by phenol/chloroform extraction and ethanol precipitation and subjected to a second round of immunopurification with anti-BrdU bead binding and washes as above. Reverse transcription was performed as follows: RNA fragments, in 8 µl water, were added to reactions with 1 µl dNTPs (10mM each), 2.5 µl 12.5uM oNTI223HIseq primer (5′-pGATCGTCGGACTGTAGAACTCT;CCTTGGCACCCGAGAATTCCATTTTTTTTTTTTTTTTTTTTVN-3’) where p indicates 5′ phosphorylation, ‘;’ indicates a furan modification that introduces a stable abasic site and VN indicates degenerate nucleotides. This mix was heated for 3 min at 75°C, chilled briefly on ice, followed by the addition of 0.5 µl SuperRase-In, 3.75 µl 0.1 M DTT, 2.5 µl 25 mM MgCl2, 5 µl 5x reverse transcription buffer, and 2 µl Superscript III reverse transcriptase (Life Technologies) and incubation at 48°C for 30 min. Excess oNTI223HIseq primer was removed by adding 3.2 µl 10X Exonuclease I buffer and 4 µl Exonuclease I (Fermentas) and incubating at 37°C for 1 hr. RNA was removed by adding 1.8 µl 1 M NaOH and incubating for 20 min at 98°C. The reaction was then neutralized with 2 µl 1 M HCl and cDNA was recovered by phenol/chloroform (pH 8) extraction and recovered by precipitation with 300 mM NaCl and three volumes of ethanol. cDNA was dissolved in 8 µl of water and added to 20 µl FLB (80% Formamide, 10 mM EDTA, 1 mg/ml Xylene Cyanol, 1 mg/ml Bromophenol Blue) and loaded on an 8% polyacrylamide TBE-urea gel. cDNA fragments of 200-650 nucleotides were excised and eluted from shattered gel slices by soaking overnight in 1x TE with 150 mM NaCl and 0.1% Tween-20. Eluates were passed through 0.22 µm spin X columns (Costar) at 10,000 rpm for 2 min at room temperature. Samples were snap frozen in liquid nitrogen and volume was reduced to <500 µl in a speed-vac and cDNA was recovered by phenol/chloroform extraction and ethanol precipitation as above. Circularization was carried out by dissolving cDNAs in 8 µl water with 1 µl CircLigase buffer, 0.5 µl mM ATP, 0.5 µl 50 mM MnCl2 and 0.5 µl CircLigase (Epicentre) and incubating at 60ºC for 1 hr, followed by heat inactivation at 80ºC for 20 min. To each reaction, 3.8 µl of 4x re-linearization supplement (100 mM KCl, 2 mM DTT) and 1.5 µl ApeI (New England Biolabs) was added and the reactions incubated at 37°C for 1hr. Re-linearized cDNA fragments were recovered by ethanol precipitation as above. To amplify single-stranded DNA fragments with adapter sequences on each end, each sample was dissolved in 15 µl water and added to 10 µl 5x Phusion HF buffer, 0.5 µl 25 µM HighSeq fwd primer (5’-AATGATACGGCGACCACCGAGATCTACACGTTCAGAGTTCTACAGTCCGA-3’), 0.5 µl 25 µM HighSeq rev primer index 1 (5’-CAAGCAGAAGACGGCATACGAGATCGTGATGTGACTGGAGTTCCTTGGCACCCGAGAATTCCA-3’), 2.5 µl 10
|
| |
|
| Library strategy |
OTHER |
| Library source |
transcriptomic |
| Library selection |
other |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
GRO-seq nascent RNA from HCT116 DMSO treated cells
|
| Data processing |
Library strategy: GRO-Seq
GRO-seq data analysis: Unless otherwise noted all data processing was carried out using custom Python scripts (Python version 2.6). The reads from three biological replicates were combined into a single file comprising 425,379,448 total reads which were mapped to the reference human genome (GRCh37/hg19) using Bowtie 0.12.7, allowing for at most 2 mismatches (Langmead et al., 2009). Using this strategy 309,772,394 (73%) of the reads mapped to the genome. The resulting SAM file was then processed by SAMtools (version 0.1.16) to create a sorted BAM file.
The sorted BAM files mentioned above were used to make a Bedgraph by running genomeCoverageBed –bg on each strand separately (v2.12.0). The negative strand values were assigned negative values in the BedGraph. The BedGraph values were then divided by the number of million mapped (309,772,394) reads to give values of reads per million per bp (rpm/bp) for each position in the genome and the two files (strands) were concatenated back together.
Genome_build: GRCh37/hg19
Supplementary_files_format_and_content: bedgraph file of reads per bp per million mapped for positive and negative strand from all three replicates
|
| |
|
| Submission date |
Apr 16, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Matthew D Galbraith |
| Organization name |
University of Colorado Anschutz Medical Campus
|
| Department |
Pharmacology & Linda Crnic Institute for Down Syndrome
|
| Street address |
RC1-N, Mail Stop 8303, Rm. P18-6114 12800 E. 19th Ave.
|
| City |
Aurora |
| State/province |
CO |
| ZIP/Postal code |
80045 |
| Country |
USA |
| |
|
| Platform ID |
GPL11154 |
| Series (1) |
|
| Relations |
| BioSample |
SAMN02046803 |
| SRA |
SRX266757 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1124062_DMSO1_2_3.BedGraph.mp.BedGraph.gz |
700.2 Mb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
