 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jun 07, 2013 |
| Title |
DFL_E12_WT_d13 |
| Sample type |
SRA |
| |
|
| Source name |
Digits Forelimbs E12.5
|
| Organism |
Mus musculus |
| Characteristics |
strain: B6CBAF1/J
tissue: Digits Forelimbs
age: E12.5
genotype: wild type
|
| Treatment protocol |
Circular Chromosome Conformation Capture (4C) technique was performed as described (Noordermeer et al., 2011). Early limb buds were dissected from 40 E9.5 embryos, Digits and Proximal forelimbs from 10X E12.5 embryos. Tissue was dissociated with collagenase (Sigma Aldrich/Fluka) and filtered through a 35 micron mesh to isolate single cells. Cells were fixed in formaldehyde 2% for 10 min at room temperature and reaction was quenched on ice with glycine. Cells were further lysated with 10 mM Tris pH 7.5, 10 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, PIC 1x to isolate nuclei. Nuclei from pools were digested with NlaIII (New England Biolabs) and ligated with T4 DNA ligase HC (Promega) in diluted conditions to promote intramolecular ligation. Sequences ligated to fragments of interest were digested again with DpnII (New England Biolabs), ligated with T4 DNA ligase HC (Promega) in diluted conditions and amplified using AmpliTaq DNA polymerase (Applied Biosystems) and inversed PCR primers flanked with adaptors allowing multiplexing. Hoxd13, Hoxd11, Hoxd9 and Hoxd1 PCR primers were described before (Noordermeer et al., 2011). For regions CNS(39) and CNS(65), the following primer sets were used: CNS(39)_inverse_forward: 5’AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTATCCAAGGAGAAAGGTGTTGGTC3', CNS(39)_inverse_reverse:5’CAAGCAGAAGACGGCATACGACAGGGCGTTGGGTCACTCT3', CNS(65)_inverse_forward:5’AATGATACGGCGACCACCGAACACTCTTTCCCTACACGACGCTCTTCCGATCTATCTAGTGAGCCCCTACCAGGA3', CNS(65)_inverse_reverse:5’CAAGCAGAAGACGGCATACGAGGAGCCTTTGGGGTACACG-3’.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Tissue was dissociated with collagenase (Sigma Aldrich/Fluka) and filtered through a 35 micron mesh to isolate single cells. Cells were fixed in formaldehyde 2% for 10 min at room temperature and reaction was quenched on ice with glycine. Cells were further lysated with 10 mM Tris pH 7.5, 10 mM NaCl, 5 mM MgCl2, 0.1 mM EGTA, PIC 1x to isolate nuclei. Nuclei from pools were digested with NlaIII (New England Biolabs) and ligated with T4 DNA ligase HC (Promega) in diluted conditions to promote intramolecular ligation
4C PCR was sequenced with Illumina Genome Analyzer IIx. Data was mapped to the mouse genome using HTSstation (http://htsstation.vital-it.ch/).
|
| |
|
| Library strategy |
OTHER |
| Library source |
genomic |
| Library selection |
other |
| Instrument model |
Illumina Genome Analyzer II |
| |
|
| Data processing |
Reads were mapped to the mm9 (NCBI m37, July 2007) Mouse genome assembly with bowtie version 0.12.7 (Langmead et al, 2009) with parameters -n 2 --best -strata -m 5. Genome coverage densities were calculated for each strand separately, then averaged and normalized by the total number of mapped reads (times 10^-7). In the the smoothed and normalized data the a normalization of local intensity over chr2:71000000-78000000(mm9) was performed.
De-multiplexing, mapping and 4C-analysis were performed through HTSstation (http://htsstation.epfl.ch) according to previously described procedure (Noordermeer et al., 2011).
Figures were made using a running mean algorithm using a window size of eleven fragments. 4C tracks were normalized to the same total intensity, over the chr2:71000000-78000000 coordinates, such as to see only changes in contacts distribution and to minimize PCR complexity bias in each samples. .
Both the mapping and the 4C-seq analysis were done through HTSstation (http://htsstation.epfl.ch/).
Genome_build: mm9
Supplementary_files_format_and_content: density files (bedGraph) and smoothed/normalized data (bedGraph), one per viewpoint, per tissue
|
| |
|
| Submission date |
Mar 24, 2013 |
| Last update date |
May 15, 2019 |
| Contact name |
Marion LELEU |
| Organization name |
EPFL
|
| Department |
School of Life Sciences
|
| Lab |
Laboratory of developmental genomics
|
| Street address |
EPFL-SV-ISREC-UPDUB- Station 19
|
| City |
Lausanne |
| ZIP/Postal code |
1015 |
| Country |
Switzerland |
| |
|
| Platform ID |
GPL9250 |
| Series (2) |
| GSE45455 |
A Switch Between Topological Domains Underlies HoxD Genes Collinearity in Mouse Limbs (4C-Seq) |
| GSE45457 |
A Switch Between Topological Domains Underlies HoxD Genes Collinearity in Mouse Limbs |
|
| Relations |
| SRA |
SRX254866 |
| BioSample |
SAMN01990925 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSM1104585_Andrey_DFL_E12_WT_HoxD13_frags_regHoxD.bedGraph.gz |
24.7 Kb |
(ftp)(http) |
BEDGRAPH |
| GSM1104585_Andrey_DFL_E12_WT_HoxD13_smoothed11.bedGraph.gz |
65.5 Kb |
(ftp)(http) |
BEDGRAPH |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
