|
|
GEO help: Mouse over screen elements for information. |
|
Status |
Public on Sep 30, 2013 |
Title |
J558.88-ED 10816 C0FNKACXX 6 |
Sample type |
SRA |
|
|
Source name |
cultured cells
|
Organism |
Mus musculus |
Characteristics |
strain: C57BL/6 genotype: Rag2-/- cell type: pro B cell primer: NOTFOUND enzyme1: ecori enzyme2: dpnii primer1: TTCCAGAACCTTCCTACCT primer2: ATCACATGTTAATCACTGCAG
|
Growth protocol |
Rag2–/– and Pax5–/– Rag2–/– pro-B cells were cultured on OP9 cells in IL-7 containing IMDM as described (Nutt et al., 1997).
|
Extracted molecule |
genomic DNA |
Extraction protocol |
Pro-B cells isolated from the bone marrow of Rag2–/–, Eμ–/– Rag2–/–, 3’RR–/– Rag2–/–, IGCR1/CBE–/– Rag2–/– and homozygous JHT mice were expanded in vitro for 4 days on OP9 cells in the presence of IL-7. Pro-B cells from the bone marrow of Rag2–/– and Rag1Cre/+ Yy1fl/fl mice were stained with CD19-PE antibody and anti-PE MACS beads prior to MACS-sorting, resulting in a purity of 94% (Figure S6B). Total thymocytes were isolated from wild-type C57BL/6J mice by passing the thymi through cell strainers and removing the dead cells by density centrifugation (Lympholyte M, Cedarlane Lab. [CEDCL5031]). The 4C-seq experiments were performed as previously described (Simonis et al., 2007) with the following modifications. For sequestration of SDS, 50 μl of 20% Triton-X 100 was incubated with the chromatin for 2-3 hours. The total amount of the primary restriction enzyme (HindIII, EcoRI or BglII) equaled 700 U and was added as follows: 300 U overnight, 200 U for 4 hours and finally 200 U for another 4-6 hours. In the second digestion round with the secondary restriction enzyme, the ligation products were incubated with 50 U of NlaIII (NEB, R0125S) overnight or 150 U of DpnII (NEB, R0543T), which were added sequentially (50 U) as described above. The digested chromatin was ligated overnight at 16oC followed by a 1 hr incubation at room temperature both for the first and the second ligation step. After ethanol precipitation, the final 4C template was purified twice using the Wizard® SV Gel and PCR Clean-Up System (Promega, A9282), each time with one column per sample prepared from 1x107 cells. The DNA concentration was measured using the Nanodrop spectrophotometer. Approximately 20 μg of 4C template was obtained from 1x107 pro-B cells. For each viewpoint, 16 individual PCR amplifications were performed with ~150 ng of 4C template each by using specific primers that were extended with Illumina sequencing adaptors. Thus, ~2.4 μg of 4C template corresponding to approximately 1x106 pro-B cells were analyzed for each viewpoint. The amplification consisted of 35 PCR cycles because 30 cycles resulted in too little product to be visualized. The PCR products of pooled reactions were purified using the Wizard® SV Gel and PCR Clean-Up System (Promega). After column purification, the PCR products obtained with the third Rag2–/– and Pax5–/– Rag2–/– replica 4C templates as well as the Eμ–/– Rag2–/–, 3’RR–/– Rag2–/–, IGCR1/CBE–/– Rag2–/– and Rag1Cre/+ Yy1fl/fl 4C templates were selected for a fragment size below 1 kb as follows. Ten percent of purified and pooled reactions were quantified on an agarose gel by measuring ethidium-bromide incorporation. Equal amounts of PCR products between 100 and 1000 bp, that were prepared from cells of the same genotype, were pooled and separated on a 2% agarose gel (Lonza [Nusieve GTG agarose, 50080]). After cutting out the lanes, agarose was degraded with β-agarase I enzyme (NEB, M0392L). The DNA was extracted twice with phenol and precipitated with ethanol after phenol removal with chloroform. The precipitate was dissolved in 10 mM Tris pH 8 and quantified by the Bioanalyzer instrument.
|
|
|
Library strategy |
OTHER |
Library source |
genomic |
Library selection |
other |
Instrument model |
Illumina HiSeq 2000 |
|
|
Data processing |
Basecalling (see below)
splitting with 3 mismatches by the primer sequence
truncation os split reads at restriction enzyme site in the primer sequence
truncation of reads at 3' end to 55nt
alignment of reads using bowtie 12.5 -v 2 --best --strata --tryhard -m 1 --chunkmbs 256
Genome_build: mm9
Supplementary_files_format_and_content: bed files of alignment
Supplementary_files_format_and_content: for all 62* files (Samples 1-33), basecalling is OLB v. 1.8; for other fastq files, basecalling is RTA VN:1.12.4.2.
|
|
|
Submission date |
Dec 18, 2012 |
Last update date |
May 15, 2019 |
Contact name |
Meinrad Busslinger |
E-mail(s) |
busslinger@imp.ac.at
|
Phone |
00431-79730
|
Organization name |
Instutute of Molecular Pathology
|
Street address |
Dr. Bohrgasse 7
|
City |
Vienna |
ZIP/Postal code |
1030 |
Country |
Austria |
|
|
Platform ID |
GPL13112 |
Series (1) |
GSE43008 |
Flexible chromatin loops in the VH gene region of the Igh locus facilitate the generation of a diverse antibody repertoire |
|
Relations |
SRA |
SRX211533 |
BioSample |
SAMN01831809 |
Supplementary file |
Size |
Download |
File type/resource |
GSM1054880_C0FNKACXX_6_20120403a_10816_20120408_J55888E_align4c.bed.gz |
364.5 Kb |
(ftp)(http) |
BED |
SRA Run Selector |
Raw data are available in SRA |
Processed data provided as supplementary file |
|
|
|
|
|