|
| Status |
Public on Dec 26, 2012 |
| Title |
Scr-Input |
| Sample type |
SRA |
| |
|
| Source name |
Embryonic stem cells, control shRNA, input
|
| Organism |
Mus musculus |
| Characteristics |
cell line: E14
cell type: embryonic stem cells (ESCs)
shRNA: shScrambled
shRNA sequence: CCTAAGGTTAAGTCGCCCTCG
chip antibody: none
|
| Treatment protocol |
KDM2B knockdown: Recombinant lentiviral particles containing scrambled or KDM2B shRNA were produced. Lentiviral infection of E14 cells was performed overnight in the presence of 4ug/mL polybrene. The following day, cells were diluted into fresh growth media and allowed to settle onto gelatine-coated dishes. Puromycin selection (1.5ug/mL) was started 48 hours following transduction, and stable lines were isolated and expanded.
|
| Growth protocol |
Regular ES media supplemented with 10ng/mL LIF. For V6.5, cells were grown for at least 2 passages under feeder-free conditions.
|
| Extracted molecule |
genomic DNA |
| Extraction protocol |
Double-crosslinked chromatin preparation. Chromatin immunoprecipitation was performed as previously described (Schmidt et al., 2009 (PMID 19275939)), with minor modifications. Cells were fixed for 1 hour in 2mM EGS, followed by 15 minutes in 1% formaldehyde, which was quenched by the addition of glycine to a final concentration of 125 uM. Sonication was performed using a BioRuptor sonicator (Diagenode) to produce fragments of approximately 500bp-1kb. Immunoprecipitation was performed overnight at 4oC with approximately 3 µg of antibody and chromatin corresponding to 5 x 10^6 cells. Antibody-bound proteins were isolated on protein A agarose beads (Repligen) or protein A magnetic Dynabeads (Invitrogen), washed extensively, eluted, and cross-links reversed according to the Upstate protocol. Samples were then sequentially treated with RNase and proteinase K before being purified on a PureLink PCR micro column (Invitrogen). Anti-KDM2A and anti-KDM2B antibodies were generated in-house. The RING1B mouse monoclonal antibody has been described previously (Atsuta et al., 2001 (PMID 11289226)).
Sequencing libraries were generated as described in Blackledge et al., 2010 (PMID 20417597) and sequenced on the Illumina HiSeq2000 platform with 51bp reads.
|
| |
|
| Library strategy |
ChIP-Seq |
| Library source |
genomic |
| Library selection |
ChIP |
| Instrument model |
Illumina HiSeq 2000 |
| |
|
| Description |
Input DNA from mESCs stably expressing control shRNAs.
|
| Data processing |
Reads were mapped to mm9 using Bowtie 0.12.7 allowing 2 mismatches.
Aligned reads were down-sampled so that all samples within an experimental condition contained the same number of reads.
Peaks were called and wig files generated using MAC14 comparing against input.
Genome_build: mm9
Supplementary_files_format_and_content: MAC14 wig files over the whole genome.
|
| |
|
| Submission date |
Sep 13, 2012 |
| Last update date |
May 15, 2019 |
| Contact name |
Ian Sudbery |
| E-mail(s) |
i.sudbery@sheffield.ac.uk
|
| Organization name |
University of Sheffield
|
| Department |
Molecular Biology and Biotechnology
|
| Lab |
Sudbery Lab for Computational Genomics
|
| Street address |
Firth Court, Western Bank
|
| City |
Sheffield |
| ZIP/Postal code |
S11 8HG |
| Country |
United Kingdom |
| |
|
| Platform ID |
GPL13112 |
| Series (2) |
| GSE40860 |
KDM2B binds CpG islands and modulates recruitment of Ring1b |
| GSE41267 |
KDM2B links the Polycomb Repressive Complex 1 (PRC1) to recognition of CpG islands |
|
| Relations |
| SRA |
SRX186549 |
| BioSample |
SAMN01173966 |
