|
| Status |
Public on May 10, 2013 |
| Title |
Gene expression profile of ETV1 knockdown in LNCaP prostate cancer cells |
| Organism |
Homo sapiens |
| Experiment type |
Expression profiling by array
|
| Summary |
Over half of prostate cancer harbor overexpression of ETS transcription factors including ERG and ETV1. LNCaP prostate cancer cells have an ETV1 translocation to the MIPOL1 locus on 14q13.3-13q21.1. To determine genes regulated by ETV1, we performed shRNA mediated knockdown of ETV1 using two lentiviral constructs as well as a scrambled shRNA in triplicate. Two pLKO.1 constructs against ETV1 (ETV1sh1: TRCN0000013923, targeting GTGGGAGTAATCTAAACATTT in 3'(B UTR; and ETV1sh2: TRCN0000013925, targeting CGACCCAGTGTATGAACACAA in exon 7) were purchased from Open Biosystems and pLKO.1 shScr (targeting CCTAAGGTTAAGTCGCCCTCG) was purchased from Addgene. RNA was harvested 3 days after infection and gene expression profiling was performed. Among genes downregulated were many well characterized androgen regulated genes.
|
| |
|
| Overall design |
LNCaP cells logarthmically growing in full serum was infected with three different shRNA lentiviruses. Three days after infection
|
| |
|
| Contributor(s) |
Chen Y, Sawyers CL |
| Citation(s) |
23817021 |
| |
| Submission date |
Apr 23, 2013 |
| Last update date |
Aug 16, 2018 |
| Contact name |
Yu Chen |
| E-mail(s) |
cheny1@mskcc.org
|
| Phone |
646-888-3356
|
| Organization name |
Memorial Sloan Kettering Cancer Center
|
| Department |
Human Oncology and Pathogenesis Program
|
| Lab |
Chen
|
| Street address |
1275 York Ave, Box 20
|
| City |
New York |
| State/province |
NY |
| ZIP/Postal code |
10065 |
| Country |
USA |
| |
|
| Platforms (1) |
| GPL6947 |
Illumina HumanHT-12 V3.0 expression beadchip |
|
| Samples (9)
|
|
| This SubSeries is part of SuperSeries: |
| GSE47220 |
ETS factors reprogram the androgen receptor cistrome and prime prostate tumorigenesis in response to PTEN loss |
|
| Relations |
| BioProject |
PRJNA202375 |
Less...
More...