|
| Status |
Public on Mar 21, 2023 |
| Title |
Transcriptional profiling for CRISPR activation of a myeloma-preferential dependency |
| Organism |
Homo sapiens |
| Experiment type |
Expression profiling by high throughput sequencing
|
| Summary |
Clinical progress in multiple myeloma (MM), an incurable plasma cell (PC) neoplasia, has been driven by therapies which have limited applications beyond MM/PC neoplasias and do not target specific oncogenic mutations in MM. Instead, these agents target pathways critical for PC biology yet largely dispensable for malignant or normal cells of most other lineages. We systematically characterized the lineage-preferential molecular dependencies of MM through genome-scale CRISPR gene editing studies in MM vs. hundreds of non-MM lines. This identified a collection of genes whose disruption has more pronounced or recurrent impact on the MM cell fitness compared to other malignancies. These genes, some known, others not previously linked to MM, encode transcription factors, chromatin modifiers, endoplasmic reticulum components, metabolic regulators or signaling molecules. The current dataset describes the transcriptional profiling of a MM cell line with CRISPR activation for the myeloma-preferential dependency, POU2AF1. The transcriptional profile of CRISPR activation of an additional gene (PANK1), which does not serve as a MM-preferential dependency in CRISPR gene editing studies, is also described.
|
| |
|
| Overall design |
LP1 cells were stably transduced with a construct for dCas9-Vp64 after lentiviral sgRNA transduction packaged with the pXPR-502 construct (RRID:Addgene_96923). LP1 cells transduced with POU2AF1 sgRNA for CRISPR-based activation of POU2AF1or control OR genes. The following sgRNA were used: PANK1_1 CACCGACGAGTTTCAACATG, PANK1_2 AGTTCTCTGGGCTTGCAGAG, POU2AF1_1 GCGCACAGTGGGGTGACAGG, POU2AF1_2 TGGCTGCAGAAACGTTGCAC, OR12D2 GAATGTCTGTCACTCCCAAG, OR6S1 GACCTGCAATTGGATAAACT
|
| |
|
| Contributor(s) |
Shirasaki R, de Matos Simoes R, Mitsiades C |
| Citation missing |
Has this study been published? Please login to update or notify GEO. |
| |
| Submission date |
Nov 02, 2021 |
| Last update date |
Mar 21, 2023 |
| Contact name |
Constantine Mitsiades |
| Organization name |
Dana-Farber Cancer Institute, Harvard Medical School
|
| Street address |
450 Brookline Avenue Dept. of Medical Oncology
|
| City |
Boston |
| State/province |
MA |
| ZIP/Postal code |
02115-5450 |
| Country |
USA |
| |
|
| Platforms (1) |
| GPL18573 |
Illumina NextSeq 500 (Homo sapiens) |
|
| Samples (18)
|
|
| Relations |
| BioProject |
PRJNA777245 |
| SRA |
SRP344218 |
Less...
More...