 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Apr 22, 2021 |
| Title |
Baiting out a full length sequence from unmapped RNA-seq data |
| Organism |
Mus musculus |
| Experiment type |
Expression profiling by high throughput sequencing
Other
|
| Summary |
Usually, unmapped reads have been considered as useless and been trashed or ignored. Here, we develop a strategy to mining the full length sequence by unmapped reads combining with specific reverse transcription primers design and high throughput sequencing. In this study, we salvage 36 unmapped reads from standard RNA-Seq data(GSM3188619) and randomly select one 149 bp read as a model(CTGGTGCCATAATTCAGGGAACTGTGTTCTTGATGTACTATCTGAGACATTTGTGCTTCCCCCCATCCAGCTATCAGGCTGTTAGGCAATGCACTTCTAGGAATTAGAATTCTATAAGGAATCTCATGCTGGAAGAACAAAAAGACCCA ). Specific reverse transcription primers(5' end:CTGGTGCCATAATTCAGGGA, 3' end:GGATCTTCACGTAACGGATTGT) are designed to amplify its both ends, followed by next generation sequencing. Then we use a statistical model base on power law distribution to estimate its integrality and significance. Further, we validate it by Sanger sequencing. The result shows that the full length is 1,556 bp, with InDel mutation in microsatellite structure. This would be a useful strategy to extract the sequences information from the unmapped RNA-seq data.
|
| |
|
| Overall design |
The library of full length sequence of unmapped reads captured by specific reverse transcription primers
|
| |
|
| Contributor(s) |
Li D, Huang Q |
| Citation(s) |
34837950 |
| |
| Submission date |
Apr 21, 2021 |
| Last update date |
Dec 10, 2021 |
| Contact name |
JING LUO |
| E-mail(s) |
luoj17@lzu.edu.cn, luojing9520@163.com
|
| Organization name |
Shenzhen agricultural Genome Research Institute, Chinese Academy of Agricultural Sciences
|
| Street address |
No 7,Pengfei Road,Dapeng District
|
| City |
Shenzhen |
| ZIP/Postal code |
518120 |
| Country |
China |
| |
|
| Platforms (1) |
| GPL24247 |
Illumina NovaSeq 6000 (Mus musculus) |
|
| Samples (1) |
|
| Relations |
| BioProject |
PRJNA723548 |
| SRA |
SRP315716 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSE172487_RAW.tar |
384.9 Mb |
(http)(custom) |
TAR (of BED, TXT) |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data provided as supplementary file |
|
|
|
|
 |
