 |
 |
GEO help: Mouse over screen elements for information. |
|
| Status |
Public on Jan 26, 2020 |
| Title |
Transcriptional profile of MESH1-silenced RCC4 cells |
| Organism |
Homo sapiens |
| Experiment type |
Expression profiling by high throughput sequencing
|
| Summary |
Nutrient deprivation triggers stringent response in bacteria, allowing rapid reallocation of resources from proliferation toward stress survival. Critical to this process is the accumulation of (p)ppGpp regulated by the RelA/SpoT homologues. While mammalian genomes encode MESH1—the homologue of the bacterial (p)ppGpp hydrolase SpoT, neither (p)ppGpp nor its synthetase has been identified in mammalian cells. Therefore, the function of MESH1 remains a mystery. Here, we report that genetic removal of MESH1 from human cell induce an extensive transcriptional response. The changes are distinct from the canonical unfolding protein response but strongly resemble the bacterial stringent response, which induce cell proliferation arrest, implicating MESH1 in a previously uncharacterized stress response in human cells.
|
| |
|
| Overall design |
human clear cell renal carcinoma cell line RCC4 were transfected by two independent siRNA targeting MESH1 (siMESH1-CDS, siMESH1-3UTR=siMESH1-7002) and compared to the control with non-targeting siRNA (siNT).
siMESH1-CDS: GGGAAUCACUGACAUUGUG, D-031786-01, Dharmacon
siMESH1-3'UTR (siMESH1-7002): CTGAAGGTCTCCTGCTAACTA, SI04167002, Qiagen
non-targeting siRNA (siNT, AllStars Negative Control siRNA, SI03650318).
|
| |
|
| Contributor(s) |
Ding CC, Chen K, Chi JA |
| Citation(s) |
34294679 |
| |
| Submission date |
May 10, 2018 |
| Last update date |
Aug 11, 2021 |
| Contact name |
Jen-Tsan Ashley Chi |
| E-mail(s) |
jentsan.chi@duke.edu
|
| Phone |
9196684759
|
| Organization name |
Duke University
|
| Lab |
Jen-Tsan Ashley Chi
|
| Street address |
101 Science Drive, DUMC 3382
|
| City |
Durham |
| State/province |
NC |
| ZIP/Postal code |
27708 |
| Country |
USA |
| |
|
| Platforms (1) |
| GPL20301 |
Illumina HiSeq 4000 (Homo sapiens) |
|
| Samples (12)
|
| GSM3138782 |
non-targeting siRNA control, biological rep 1 |
| GSM3138783 |
non-targeting siRNA control, biological rep 2 |
| GSM3138784 |
non-targeting siRNA control, biological rep 3 |
| GSM3138785 |
siMESH1-CDS, biological rep 1 |
| GSM3138786 |
siMESH1-CDS, biological rep 2 |
| GSM3138787 |
siMESH1-CDS, biological rep 3 |
| GSM3141423 |
non-targeting siRNA control (for siMESH1-7002), biological rep 1 |
| GSM3141424 |
non-targeting siRNA control (for siMESH1-7002), biological rep 2 |
| GSM3141425 |
non-targeting siRNA control (for siMESH1-7002), biological rep 3 |
| GSM3141426 |
siMESH1-7002, biological rep 1 |
| GSM3141427 |
siMESH1-7002, biological rep 2 |
| GSM3141428 |
siMESH1-7002, biological rep 3 |
|
| Relations |
| BioProject |
PRJNA470796 |
| SRA |
SRP145252 |
| Supplementary file |
Size |
Download |
File type/resource |
| GSE114282_HTSeq-DESeq2.siMESH1-7002.siNT.out.txt.gz |
541.4 Kb |
(ftp)(http) |
TXT |
| GSE114282_HTSeq-DESeq2.siMESH1-CDS.siNT.out.txt.gz |
779.2 Kb |
(ftp)(http) |
TXT |
| GSE114282_RAW.tar |
1.1 Mb |
(http)(custom) |
TAR (of TXT) |
SRA Run Selector |
| Raw data are available in SRA |
| Processed data are available on Series record |
| Processed data provided as supplementary file |
|
|
|
|
 |
Less...
More...