| Data table |
| ID |
GB_ACC |
Unigene |
GeneID |
Organism |
Name |
Description |
Symbol |
Chromosome |
Protein_Acc |
MapLocation |
Synonyms |
Summary_Func |
SEQUENCE |
SPOT_ID |
Unigene_Build |
| H200000001 |
NM_000015 |
Hs.2 |
10 |
Hs |
N-acetyltransferase 2 (arylamine N-acetyltransferase) |
N-acetyltransferase 2 (arylamine N-acetyltransferase) |
NAT2 |
8 |
NP_000006 |
8p22 |
AAC2 |
"The intronless NAT2 gene encodes N-acetyltransferase 2 (arylamine N-acetyltransferase 2). This enzyme functions to both activate and deactivate arylamine and hydrazine drugs and carcinogens. Polymorphisms in this gene are reponsible for the N-acetylation polymorphism in which human populations segregate into rapid,intermediate, and slow acetylator phenotypes. Polymorphisms in NAT2 are also associated with higher incidences of cancer and drug toxicity.A second arylamine N-acetyltransferase gene (NAT1) is located near NAT2." |
TGGGGAGAAATCTCGTGCCCAAACCTGGTGATGGATCCCTTACTATTTAGAATAAGGAACAAAATAAAC |
|
UniGene Build #182 Homo sapiens |
| H200000002 |
AF153821 |
Hs.4 |
125 |
Hs |
"Alcohol dehydrogenase IB (class I), beta polypeptide" |
"alcohol dehydrogenase IB (class I), beta polypeptide" |
ADH1B |
4 |
NP_000659 |
4q21-q23 |
ADH2 |
"The protein encoded by this gene is a member of the alcohol dehydrogenase family. Members of this enzyme family metabolize a wide variety of substrates, including ethanol, retinol, other aliphatic alcohols, hydroxysteroids, and lipid peroxidation products. This encoded protein, consisting of several homo- and heterodimers of alpha, beta, and gamma subunits, exhibits high activity for ethanol oxidation and plays a major role in ethanol catabolism. Three genes encoding alpha, beta and gamma subunits are tandemly organized in a genomic segment as a gene cluster." |
TCCTGCTAGTGACACAGAAGCTGACATCCAGCTCCCACCCGCCTTCCTCCCAGGTTCGGGGAGCAGGTA |
|
UniGene Build #182 Homo sapiens |
| H200000003 |
NM_001815 |
Hs.11 |
1084 |
Hs |
Carcinoembryonic antigen-related cell adhesion molecule 3 |
carcinoembryonic antigen-related cell adhesion molecule 3 |
CEACAM3 |
19 |
NP_001806 |
19q13.2 |
CD66D|CEA|CGM1|MGC119875|W264|W282 |
|
CCAAAACTGGAAGGCCGTGGTCCCTCCCACAGCTCTGCCTTCTCGATGTCCCCTCTCTCCACTGCCTAG |
|
UniGene Build #182 Homo sapiens |
| H200000004 |
NM_001817 |
Hs.12 |
1089 |
Hs |
Carcinoembryonic antigen-related cell adhesion molecule 4 |
carcinoembryonic antigen-related cell adhesion molecule 4 |
CEACAM4 |
19 |
NP_001808 |
19q13.2 |
CGM7|CGM7_HUMAN|NCA |
|
TGAATAAAGAGGACCCTTCCTCTCATTGGCTCTTTTTCTGCTCACGGGAACTTAGCAGAAACTCACCTG |
|
UniGene Build #182 Homo sapiens |
| H200000005 |
NM_000359 |
Hs.508950 |
7051 |
Hs |
"Transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)" |
"transglutaminase 1 (K polypeptide epidermal type I, protein-glutamine-gamma-glutamyltransferase)" |
TGM1 |
14 |
NP_000350 |
14q11.2 |
ICR2|KTG|LI|LI1|TGASE|TGK |
|
GAAGGCTCTGGGTTACAGAGGCCCAAGATCCTCAACGTTGGGGACATTGGAGGCAATGAAACAGTGACA |
|
UniGene Build #182 Homo sapiens |
| H200000006 |
NM_000140 |
Hs.465221 |
2235 |
Hs |
Ferrochelatase (protoporphyria) |
ferrochelatase (protoporphyria) |
FECH |
18 |
NP_000131 |
18q21.3 |
EPP|FCE |
Ferrochelatase is localized to the mitochondrion where it catalyzes the insertion of ferrous form of iron into protoporphyrin IX in the heme synthesis pathway. Defects in ferrochelatase are associated with protoporphyria. |
ATGGGTTACAGAATGCTAGGGAGGCAATTTGGTTACCTGCAATGGCTGCTTTTGCCAGCGAGGCCACCA |
|
UniGene Build #182 Homo sapiens |
| H200000007 |
NM_000170 |
Hs.149156 |
2731 |
Hs |
"Glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)" |
glycine dehydrogenase (decarboxylating) |
GLDC |
9 |
NP_000161 |
9p22 |
GCE|GCSP|HYGN1|MGC138198|MGC138200|NKH |
"The enzyme system for cleavage of glycine (glycine cleavage system; GCS; EC 2.1.2.10), which is confined to the mitochondria, is composed of 4 protein components: P protein (a pyridoxal phosphate-dependent glycine decarboxylase), H protein (a lipoic acid-containing protein), T protein (a tetrahydrofolate-requiring enzyme), and L protein (a lipoamide dehydrogenase). Glycine encephalopathy (GCE; MIM 605899) may be due to a defect in any one of these enzymes; see MIM 238310, MIM 238330, and MIM 238331.[supplied by OMIM]" |
TATGGAGATCAGCACCTGGTTTGTACCTGCCCACCCATGGAAGTTTATGAGTCTCCATTTTCTGAACAA |
|
UniGene Build #182 Homo sapiens |
| H200000008 |
NM_000139 |
Hs.386748 |
2206 |
Hs |
"Membrane-spanning 4-domains, subfamily A, member 1" |
"membrane-spanning 4-domains, subfamily A, member 2 (Fc fragment of IgE, high affinity I, receptor for; beta polypeptide)" |
MS4A2 |
11 |
NP_000130 |
11q13 |
APY|ATOPY|FCER1B|FCERI|IGEL|IGER|IGHER|MS4A1 |
"The allergic response involves the binding of allergen to receptor-bound IgE followed by cell activation and the release of mediators responsible for the manifestations of allergy. The IgE-receptor, a tetramer composed of an alpha, beta, and 2 disulfide-linked gamma chains, is found on the surface of mast cells and basophils. This gene encodes the beta subunit of the high affinity IgE receptor which is a member of the membrane-spanning 4A gene family. Members of this nascent protein family are characterized by common structural features and similar intron/exon splice boundaries and display unique expression patterns among hematopoietic cells and nonlymphoid tissues. This family member is localized to 11q12, among a cluster of family members." |
GTCATCTTCTCCATGAAGACCACTGAATGAACACCTTTTCATCCAGCCTTAATTTCTTGCTCCATAACT |
|
UniGene Build #182 Homo sapiens |
| H200000009 |
M64322 |
Hs.402773 |
5778 |
Hs |
"Protein tyrosine phosphatase, non-receptor type 7" |
"protein tyrosine phosphatase, non-receptor type 7" |
PTPN7 |
1 |
NP_542156 |
1q32.1 |
BPTP-4|HEPTP|LC-PTP|LPTP|PTPNI |
"The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This gene is preferentially expressed in a variety of hematopoietic cells, and is an early response gene in lymphokine stimulated cells. The noncatalytic N-terminus of this PTP can interact with MAP kinases and suppress the MAP kinase activities. This PTP was shown to be involved in the regulation of T cell antigen receptor (TCR) signaling, which was thought to function through dephosphorylating the molecules related to MAP kinase pathway. Three alternatively spliced transcript variants of this gene, which encode two distinct isoforms, are reported." |
CATGGTTGCTGGCCACTCCCACCAACTACTCTTAGGGAGGCTAAGCAGTCTCTGTTTTGACCTTCCATG |
|
UniGene Build #182 Homo sapiens |
| H200000010 |
NM_000595 |
Hs.36 |
4049 |
Hs |
"Lymphotoxin alpha (TNF superfamily, member 1)" |
"lymphotoxin alpha (TNF superfamily, member 1)" |
LTA |
6 |
NP_000586 |
6p21.3 |
LT|TNFB|TNFSF1 |
"Lymphotoxin alpha, a member of the tumor necrosis factor family, is a cytokine produced by lymphocytes. LTA is highly inducible, secreted, and exists as homotrimeric molecule. LTA forms heterotrimers with lymphotoxin-beta which anchors lymphotoxin-alpha to the cell surface. LTA mediates a large variety of inflammatory, immunostimulatory, and antiviral responses. LTA is also involved in the formation of secondary lymphoid organs during development and plays a role in apoptosis." |
CATGGAGGAGCTTGGGGGATGACTAGAGGCAGGGAGGGGACTATTTATGAAGGCAAAAAAATTAAATTA |
|
UniGene Build #182 Homo sapiens |
| H200000011 |
NM_000019 |
Hs.232375 |
38 |
Hs |
Acetyl-Coenzyme A acetyltransferase 1 (acetoacetyl Coenzyme A thiolase) |
acetyl-Coenzyme A acetyltransferase 1 (acetoacetyl Coenzyme A thiolase) |
ACAT1 |
11 |
NP_000010 |
11q22.3-q23.1 |
ACAT|MAT|T2|THIL |
"This gene encodes a mitochondrially localized enzyme that catalyzes the reversible formation of acetoacetyl-CoA from two molecules of acetyl-CoA. This gene spans approximately 27 kb and contains 12 exons interrupted by 11 introns. Defects in this gene are associated with the alpha-methylacetoaceticaciduria disorder, an inborn error of isoleucine catabolism characterized by urinary excretion of 2-methyl-3-hydroxybutyric acid, 2-methylacetoacetic acid, tiglylglycine, and butanone." |
GAACAGGACGCTTATGCTATTAATTCTTATACCAGAAGTAAAGCAGCATGGGAAGCTGGGAAATTTGGA |
|
UniGene Build #182 Homo sapiens |
| H200000012 |
NM_001816 |
Hs.41 |
1088 |
Hs |
Carcinoembryonic antigen-related cell adhesion molecule 8 |
carcinoembryonic antigen-related cell adhesion molecule 8 |
CEACAM8 |
19 |
NP_001807 |
19q13.2 |
CD66b|CD67|CGM6|NCA-95 |
|
TGATAACTTTAAGATCACGCCACTGGACTGTCTATGAACTTGCAAACAGGCTGATACCTTTGTGAAGTT |
|
UniGene Build #182 Homo sapiens |
| H200000013 |
NM_002825 |
Hs.371249 |
5764 |
Hs |
"Pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1)" |
"pleiotrophin (heparin binding growth factor 8, neurite growth-promoting factor 1)" |
PTN |
7 |
NP_002816 |
7q33-q34 |
HARP|HBGF8|HBNF|NEGF1 |
|
TCAGAATGAGTATTTGGTTTAGAGTTTGGCAACATATGCCATATGCTGGCTGCCATGAACAAAGGTGGC |
|
UniGene Build #182 Homo sapiens |
| H200000014 |
NM_000952 |
Hs.46 |
5724 |
Hs |
Platelet-activating factor receptor |
platelet-activating factor receptor |
PTAFR |
1 |
NP_000943 |
1p35-p34.3 |
PAFR |
"PTAFR shows structural characteristics of the rhodopsin (MIM 180380) gene family and binds platelet-activating factor (PAF). PAF is a phospholipid (1-0-alkyl-2-acetyl-sn-glycero-3-phosphorylcholine) that has been implicated as a mediator in diverse pathologic processes, such as allergy, asthma, septic shock, arterial thrombosis, and inflammatory processes.[supplied by OMIM]" |
GTGCTGTGGGTCTTTGCCCGCCTGTACCCTTGCAAGAAATTCAATGAGATAAAGATCTTCATGGTGAAC |
|
UniGene Build #182 Homo sapiens |
| H200000015 |
D13265 |
Hs.446291 |
4481 |
Hs |
Macrophage scavenger receptor 1 |
macrophage scavenger receptor 1 |
MSR1 |
8 |
NP_619730 |
8p22 |
CD204|SCARA1|SR-A|phSR1|phSR2 |
"This gene encodes the class A macrophage scavenger receptors, which include three different types (1, 2, 3) generated by alternative splicing of this gene. These receptors or isoforms are macrophage-specific trimeric integral membrane glycoproteins and ha" |
CTACCATCTCATTAAAAGGCCCTTCACCTCTGGACAAGTCATCTGCAACAACTGACTTCCAAGATCCTT |
|
UniGene Build #182 Homo sapiens |
| H200000016 |
NM_002641 |
Hs.137154 |
5277 |
Hs |
"Phosphatidylinositol glycan, class A (paroxysmal nocturnal hemoglobinuria)" |
"phosphatidylinositol glycan anchor biosynthesis, class A (paroxysmal nocturnal hemoglobinuria)" |
PIGA |
X |
NP_065206 |
Xp22.1 |
GPI3|PIG-A |
"This gene encodes a protein required for synthesis of N-acetylglucosaminyl phosphatidylinositol (GlcNAc-PI), the first intermediate in the biosynthetic pathway of GPI anchor. The GPI anchor is a glycolipid found on many blood cells and which serves to anchor proteins to the cell surface. Paroxysmal nocturnal hemoglobinuria, an acquired hematologic disorder, has been shown to result from mutations in this gene. Three mRNA species have been described that result from alternative splicing of exon 2." |
TGCACTGGTCGGTATATGGAAACACATTGCTCTACCCTGCTACTTAGTTGATTTTAAAGTGAATTTACA |
|
UniGene Build #182 Homo sapiens |
| H200000017 |
NM_002764 |
Hs.56 |
5631 |
Hs |
Phosphoribosyl pyrophosphate synthetase 1 |
phosphoribosyl pyrophosphate synthetase 1 |
PRPS1 |
X |
NP_002755 |
Xq21-q27 |
KIAA0967|PRS I|PRSI |
|
CAGGATATTAGAGGTTATCCGAACTGGGGAAAGACGGATTGAGATTAACTGCTGGACCTCCTACCTGCA |
|
UniGene Build #182 Homo sapiens |
| H200000018 |
NM_002835 |
Hs.61812 |
5782 |
Hs |
"Protein tyrosine phosphatase, non-receptor type 12" |
"protein tyrosine phosphatase, non-receptor type 12" |
PTPN12 |
7 |
NP_002826 |
7q11.23 |
PTP-PEST|PTPG1 |
"The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains a C-terminal PEST motif, which serves as a protein-protein interaction domain, and may be related to protein intracellular half-life. This PTP was found to bind and dephosphorylate the product of oncogene c-ABL, thus may play a role in oncogenesis. This PTP was shown to interact with, and dephosphorylate, various of cytoskeleton and cell adhesion molecules, such as p130 (Cas), CAKbeta/PTK2B, PSTPIP1, and paxillin, which suggested its regulatory roles in controlling cell shape and mobility." |
AGAAATGTGATCATCCAGCGGGAGGTATTCACTATGAAATGTGCATAGAATGTCCACCTACTTTCAGTG |
|
UniGene Build #182 Homo sapiens |
| H200000019 |
NM_003000 |
Hs.465924 |
6390 |
Hs |
"Succinate dehydrogenase complex, subunit B, iron sulfur (Ip)" |
"succinate dehydrogenase complex, subunit B, iron sulfur (Ip)" |
SDHB |
1 |
NP_002991 |
1p36.1-p35 |
IP|PGL4|SDH|SDH1|SDHIP |
"Complex II of the respiratory chain, which is specifically involved in the oxidation of succinate, carries electrons from FADH to CoQ. The complex is composed of four nuclear-encoded subunits and is localized in the mitochondrial inner membrane. The iron-sulfur subunit is highly conserved and contains three cysteine-rich clusters which may comprise the iron-sulfur centers of the enzyme." |
AGACAAGGCTGGAGACAAACCTCATATGCAGACTTATAAGGTTGACCTTAATAAATGTGGCCCCATGGT |
|
UniGene Build #182 Homo sapiens |
| H200000020 |
NM_016232 |
Hs.66 |
9173 |
Hs |
Interleukin 1 receptor-like 1 |
interleukin 1 receptor-like 1 |
IL1RL1 |
2 |
NP_775661 |
2q12 |
DER4|FIT-1|MGC32623|ST2|ST2L|ST2V|T1 |
"The protein encoded by this gene is a member of the interleukin 1 receptor family. Studies of the similar gene in mouse suggested that this receptor can be induced by proinflammatory stimuli, and may be involved in the function of helper T cells. This gene, interleukin 1 receptor, type I (IL1R1), interleukin 1 receptor, type II (IL1R2) and interleukin 1 receptor-like 2 (IL1RL2) form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. Three alternatively spliced transcript variants encoding distinct isoforms have been reported." |
TCCAAATTCTGGAAGCACGTGAGGTACCAAATGCCTGTGCCAAGCAAAATTCCCAGAAAGGCCTCTAGT |
|
UniGene Build #182 Homo sapiens |
