NCBI Logo
GEO Logo
   NCBI > GEO > Accession DisplayHelp Not logged in | LoginHelp
GEO help: Mouse over screen elements for information.
          Go
Platform GPL4253 Query DataSets for GPL4253
Status Public on Jan 01, 2007
Title Affymetrix Research Exon Array
Technology type in situ oligonucleotide
Distribution custom-commercial
Organism Homo sapiens
Manufacturer Affymetrix, Inc.
Manufacture protocol 4 GeneChip Set (A, B, C, D) with 8um feature pitch that is manufactured using standard Affymetrix in-situ synthesis. Probes are 25-mers that are designed to detect anti-sense target.
 
Description 4 Chip set, 49-format, 8um feature pitch. Approximately 1.4 million probesets designed to detect more than 1 million exons. Each probeset has up to 4 PM + MM probepairs.
The Research Exon Array annotation is based on the Nov 2002 version of the Human Genome, NCBI Build 33.
 
Contributor(s) Clark TA, Schweitzer AC, Wang H, Williams A, Blume JE
Submission date Aug 31, 2006
Last update date Jan 01, 2007
Contact name Tyson A Clark
E-mail(s) tclark@pacificbiosciences.com
Phone 650-521-8319
Organization name Pacific Biosciences
Street address 1380 Willow Rd.
City Menlo Park
State/province CA
ZIP/Postal code 94025
Country USA
 
Samples (48) GSM135331, GSM135332, GSM135333, GSM135334, GSM135335, GSM135336 
Series (1)
GSE5791 Affymetrix Research Exon Array Tissue Panel Data

Data table header descriptions
ID
PS_ANNOTATION Indicates if the probeset is Supported (S) or Bounded (B) by an Ensembl/RefSeq Transcript Cluster, hits Multiple (M) Transcript Clusters, or falls outside a transcript cluster (no_trans_cluster_assoc)
PS_TYPE Indicates uniqueness of probeset (null = probeset is unique, _x = one or more probes has multiple hits to the genome, _s = all probes map to multiple genome locations)
TRANSCRIPT_CLUSTER ID of the Transcript Cluster (gene) that the probeset belongs to in the format chr_TCstart_TCstop
POSITION_IN_TC Relative position (percentage) of the probeset within the Transcript Cluster (0 = 5' end, 100 = 3' end)
SLAM Is probeset supported by a SLAM prediction (1 = yes, 0 = no)
ENSEMBL Is probeset supported by an Ensembl annotation (1 = yes, 0 = no)
EST Is probeset supported by an EST sequence (1 = yes, 0 = no)
FL Is probeset supported by a Full Length mRNA sequence (1 = yes, 0 = no)
GENSCAN Is probeset supported by a GenScan prediction (1 = yes, 0 = no)
GENSCAN_SUBOPT Is probeset supported by a GenScan Suboptimal Exon prediction (1 = yes, 0 = no)
mRNA Is probeset supported by an mRNA sequence (1 = yes, 0 = no)
TWINSCAN Is probeset supported by a TwinScan prediction (1 = yes, 0 = no)
GENE Gene Name, if available
ENSEMBL_TRANSCRIPTS Ensembl Transcript IDs, if available
REFSEQ_TRANSCRIPTS RefSeq Transcript IDs, if available
GENE_DESCRIPTION Description of protein encoded by the gene, if available
CHROMOSOME Chromosome location of the probeset sequence
STRAND Strand of the probeset sequence (+ or -)
START_COORD Start Coordinate of the probeset sequence
STOP_COORD Stop Coordinate of the probeset sequence
SIZE Size (in bp) of the probeset sequence
PROBESET_SEQUENCE Probeset sequence. Includes sequence covered by the probeset, from the 5' most probe to the 3' most probe (may be smaller than the exon or PSR sequence)

Data table
ID PS_ANNOTATION PS_TYPE TRANSCRIPT_CLUSTER POSITION_IN_TC SLAM ENSEMBL EST FL GENSCAN GENSCAN_SUBOPT mRNA TWINSCAN GENE ENSEMBL_TRANSCRIPTS REFSEQ_TRANSCRIPTS GENE_DESCRIPTION CHROMOSOME STRAND START_COORD STOP_COORD SIZE PROBESET_SEQUENCE
83018508 no_trans_cluster_assoc _t null null 0 0 1 0 0 0 0 0 null null null null chr10_random + 41491 41514 24bp aaaagcagaaattaaaagcagctg
83018510 no_trans_cluster_assoc _t null null 0 0 1 0 0 0 0 0 null null null null chr10_random + 127713 127732 20bp gttcatagcagcctgactca
83018512 no_trans_cluster_assoc _t null null 0 0 0 0 1 0 0 0 null null null null chr10_random - 2602 2619 18bp ccctggccaatcttctag
83018514 no_trans_cluster_assoc _t null null 0 0 0 0 0 1 0 0 null null null null chr10_random - 35104 35122 19bp ttgtttggtgtctggtcag
83018516 no_trans_cluster_assoc _t null null 0 0 0 0 0 1 0 0 null null null null chr10_random - 64395 64415 21bp gtgagtgtacactcactgtga
83018518 no_trans_cluster_assoc _t null null 0 0 0 0 0 1 0 0 null null null null chr10_random - 64935 64952 18bp gtgagttgtttaaatcag
83018520 no_trans_cluster_assoc _t null null 0 0 0 0 0 1 0 0 null null null null chr1 + 22706 22726 21bp atggagaataagacgaaaaat
83018522 no_trans_cluster_assoc _t null null 0 0 0 0 1 0 0 0 null null null null chr1 + 147493 147515 23bp gacccacccgaggacgggtcacc
83018524 no_trans_cluster_assoc _t null null 0 0 0 0 0 1 0 0 null null null null chr1 + 178085 178104 20bp gtactgcccatcagggtaat
83018526 no_trans_cluster_assoc _t null null 0 0 0 0 0 1 0 0 null null null null chr1 + 184069 184092 24bp gtcattttggttttcccgggatag
83018528 no_trans_cluster_assoc _t null null 0 0 0 0 0 1 0 0 null null null null chr1 + 350872 350890 19bp acaggagacagtaagagaa
83018530 no_trans_cluster_assoc _t null null 0 0 0 0 0 1 0 0 null null null null chr1 + 427591 427611 21bp aaaggcatgatgaaaatttaa
83018532 no_trans_cluster_assoc _t null null 0 0 0 0 1 0 0 0 null null null null chr1 + 463412 463432 21bp ctggcacactttttccagtag
83018534 no_trans_cluster_assoc _t null null 0 0 0 0 1 0 0 0 null null null null chr1 + 491272 491291 20bp ccgtcattaaacctgtttaa
83018536 no_trans_cluster_assoc _t null null 0 1 0 1 0 0 0 0 null null null null chr1 + 581946 581962 17bp gtgagcttctgtcctag
83018538 no_trans_cluster_assoc _t null null 0 0 0 0 0 1 0 0 null null null null chr1 + 599385 599406 22bp ctgtgactcctgcgtgacccgc
83018540 no_trans_cluster_assoc _t null null 0 1 1 1 1 1 1 1 null null null null chr1 + 599513 599532 20bp gcgaggctgcccggagtccg
83018542 no_trans_cluster_assoc _t null null 0 1 1 1 1 1 1 1 null null null null chr1 + 599543 599561 19bp gcgggagcccctcggccag
83018544 no_trans_cluster_assoc _t null null 0 0 1 0 0 1 0 0 null null null null chr1 + 601447 601464 18bp ctcagcctttctgtgcag
83018546 no_trans_cluster_assoc _t null null 0 1 1 1 1 0 1 1 null null null null chr1 + 604463 604486 24bp gcttacctgggctcggccatacag

Total number of rows: 1359271

Table truncated, full table size 392098 Kbytes.




Download family Format
SOFT formatted family file(s) SOFTHelp
MINiML formatted family file(s) MINiMLHelp

Supplementary data files not provided
| NLM | NIH | GEO Help | Disclaimer | Accessibility |
NCBI Home NCBI Search NCBI SiteMap