ClinVar for Gene (Select 728224) - ClinVar

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 25

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 3117078	NM_031960.3(KRTAP4-8):c.467G>A (p.Gly156Asp)	KRTAP4-8 (G156D +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3117077	NM_031960.3(KRTAP4-8):c.436C>T (p.Arg146Cys)	KRTAP4-8 (R146C +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3117076	NM_031960.3(KRTAP4-8):c.386G>T (p.Cys129Phe)	KRTAP4-8 (C129F +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3117075	NM_031960.3(KRTAP4-8):c.274C>A (p.Pro92Thr)	KRTAP4-8 (P102T +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3117074	NM_031960.3(KRTAP4-8):c.224G>T (p.Cys75Phe)	KRTAP4-8 (C85F +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3117073	NM_031960.3(KRTAP4-8):c.196C>T (p.Arg66Cys)	KRTAP4-8 (R66C +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3117072	NM_031960.3(KRTAP4-8):c.115T>A (p.Cys39Ser)	KRTAP4-8 (C39S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2647753	NM_031960.3(KRTAP4-8):c.189_194CTG[2]CCACCCCAGATGCTGCATCTCCAGCTGCTG[1] (p.Cys65_Arg66insHisProArgCysCysIleSerSerCysCys)	KRTAP4-8	Microsatellite (inframe_insertion)	not provided	GLikely benign
Select item 2555336	NM_031960.3(KRTAP4-8):c.377G>T (p.Arg126Leu)	KRTAP4-8 (H136L +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2530586	NM_031960.3(KRTAP4-8):c.431G>C (p.Cys144Ser)	KRTAP4-8 (C144S +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2524939	NM_031960.3(KRTAP4-8):c.527G>A (p.Arg176His)	KRTAP4-8 (R176H +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2517996	NM_031960.3(KRTAP4-8):c.532G>C (p.Val178Leu)	KRTAP4-8 (V178L +1 more)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2457096	NM_031960.3(KRTAP4-8):c.25G>A (p.Val9Met)	KRTAP4-8 (V9M)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2286835	NM_031960.3(KRTAP4-8):c.227A>G (p.Lys76Arg)	KRTAP4-8 (K76R +1 more)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2276737	NM_031960.3(KRTAP4-8):c.488C>T (p.Thr163Ile)	KRTAP4-8 (T163I +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2264672	NM_031960.3(KRTAP4-8):c.532G>A (p.Val178Met)	KRTAP4-8 (V178M +1 more)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2208048	NM_031960.3(KRTAP4-8):c.541G>A (p.Ala181Thr)	KRTAP4-8 (A181T +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 564445	GRCh37/hg19 17q21.2(chr17:39043189-39492499)x1	KRT23, KRT39 +33 more	Copy number loss	not provided	GLikely benign
Select item 441816	GRCh37/hg19 17p13.3-q25.3(chr17:526-81041938)x3	TNFSF12, TNFSF12-TNFSF13 +1143 more	Copy number gain	See cases	GPathogenic
Select item 441815	GRCh37/hg19 17p13.3-q25.3(chr17:526-81041938)	AIPL1, AKAP1 +1143 more	Copy number gain	See cases	GPathogenic
Select item 403023	NM_031960.3(KRTAP4-8):c.502G>A (p.Ala168Thr)	KRTAP4-8 (A168T)	Single nucleotide variant (no sequence alteration +1 more)	not specified	GBenign
Select item 148630	GRCh38/hg38 17q21.2(chr17:40927571-41313858)x1	KRT23, KRT39 +36 more	Copy number loss	See cases	GLikely benign
Select item 148363	GRCh38/hg38 17q23.1-25.1(chr17:36449220-75053130)x3	ABCA10, ADAM11 +2032 more	Copy number gain	See cases	GPathogenic
Select item 58696	GRCh38/hg38 17q12-21.31(chr17:39199873-45629579)x3	AARSD1, ACBD4 +633 more	Copy number gain	See cases	GPathogenic
Select item 57282	GRCh38/hg38 17q21.33-24.2(chr17:36449220-68170214)x3	LOC130060795, LOC130060796 +1753 more	Copy number gain	See cases	GPathogenic

ClinVar

Result Filters

Classification type

Germline classification

Types of conflicts

Molecular consequence

Variation type

Variation size

Variant length

Review status

Additional filters

Links from Gene

Items: 25