ClinVar for Gene (Select 51213) - ClinVar - NCBI

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 1 to 100 of 192

<< First< Prev

Page of 2

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 3366901	NC_000023.10:g.(?_54610638)_(154689386_?)dup	ABCB7, ABCD1 +526 more	Duplication	Hereditary factor VIII deficiency disease	GUncertain significance
Select item 3292330	NM_016383.5(LUZP4):c.578A>G (p.Gln193Arg)	LUZP4 (Q193R +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3292329	NM_016383.5(LUZP4):c.289T>G (p.Ser97Ala)	LUZP4 (S97A)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 3292328	NM_016383.5(LUZP4):c.833G>A (p.Arg278Lys)	LUZP4 (R196K +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3292327	NM_016383.5(LUZP4):c.779T>C (p.Ile260Thr)	LUZP4 (I260T +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3246674	NC_000023.10:g.(?_113818282)_(115590299_?)del	AGTR2, DANT2 +8 more	Deletion	not provided	GPathogenic
Select item 3242589	GRCh38/hg38 Xp22.33-q28(chrX:2757837-156030895)x2	LOC130068417, LOC130068418 +2599 more	Copy number gain	Klinefelter syndrome	GPathogenic
Select item 3121595	NM_016383.5(LUZP4):c.902A>G (p.His301Arg)	LUZP4 (H301R +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3121594	NM_016383.5(LUZP4):c.318A>C (p.Leu106Phe)	LUZP4 (L106F)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 3062473	GRCh37/hg19 Xq22.2-28(chrX:103405294-155233731)	ABCD1, ACSL4 +321 more	Copy number loss	not specified	GPathogenic
Select item 3056343	NM_016383.5(LUZP4):c.600A>G (p.Gln200=)	LUZP4	Single nucleotide variant (synonymous variant)	LUZP4-related disorder	GBenign
Select item 3050593	NM_016383.5(LUZP4):c.770_790del (p.Lys257_Gln263del)	LUZP4	Deletion	LUZP4-related disorder	GLikely benign
Select item 3049401	NM_016383.5(LUZP4):c.625GAGAGATCTCATGGTCACTCA[2] (p.202ERSHGHS[3])	LUZP4	Microsatellite	LUZP4-related disorder	GLikely benign
Select item 3039850	NM_016383.5(LUZP4):c.916A>G (p.Thr306Ala)	LUZP4 (T224A +1 more)	Single nucleotide variant (missense variant)	LUZP4-related disorder	GLikely benign
Select item 3035565	NM_016383.5(LUZP4):c.537G>A (p.Gln179=)	LUZP4	Single nucleotide variant (synonymous variant)	LUZP4-related disorder	GLikely benign
Select item 3024654	GRCh37/hg19 Xq12-28(chrX:67292994-155240074)x3	CT47A5, NXF3 +488 more	Copy number gain	not provided	GPathogenic
Select item 2685761	GRCh37/hg19 Xq23-25(chrX:110921170-124327177)x2	AGTR2, AKAP14 +66 more	Copy number gain	not provided	GPathogenic
Select item 2685715	GRCh37/hg19 Xq21.31-25(chrX:91274467-126799984)x1	ACSL4, AGTR2 +175 more	Copy number loss	not provided	GPathogenic
Select item 2685122	GRCh37/hg19 Xq23(chrX:114532189-114598074)x0	LUZP4	Copy number loss	not provided	GUncertain significance
Select item 2684996	GRCh37/hg19 Xq21.1-24(chrX:77212972-118576590)x3	ACSL4, AGTR2 +159 more	Copy number gain	not provided	GPathogenic
Select item 2661252	NC_000023.11:g.115455133A>G	LUZP4	Single nucleotide variant	not provided	GLikely benign
Select item 2661251	NM_016383.5(LUZP4):c.852G>A (p.Glu284=)	LUZP4	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2661250	NM_016383.5(LUZP4):c.770A>G (p.Lys257Arg)	LUZP4 (K175R +1 more)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 2661249	NM_016383.5(LUZP4):c.469CAT[1] (p.His158del)	LUZP4 (H158del +1 more)	Microsatellite (inframe_deletion)	not provided	GLikely benign
Select item 2661248	NM_016383.5(LUZP4):c.13C>T (p.Arg5Trp)	LUZP4 (R5W)	Single nucleotide variant (5 prime UTR variant +1 more)	not provided	GLikely benign
Select item 2618358	NM_016383.5(LUZP4):c.635A>T (p.His212Leu)	LUZP4 (H212L +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2607930	NM_016383.5(LUZP4):c.394T>A (p.Ser132Thr)	LUZP4 (S50T +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2561833	NM_016383.5(LUZP4):c.442G>A (p.Glu148Lys)	LUZP4 (E66K +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2552096	NM_016383.5(LUZP4):c.527C>G (p.Ser176Cys)	LUZP4 (S176C +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2548541	NM_016383.5(LUZP4):c.86C>T (p.Ser29Phe)	LUZP4 (S29F)	Single nucleotide variant (5 prime UTR variant +1 more)	not specified	GUncertain significance
Select item 2546785	NM_016383.5(LUZP4):c.538C>G (p.Leu180Val)	LUZP4 (L98V +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2506546	GRCh37/hg19 Xp22.33-q28(chrX:200855-155240074)	ABCB7, ABCD1 +818 more	Copy number gain	Klinefelter syndrome	GPathogenic
Select item 2472779	NM_016383.5(LUZP4):c.308A>C (p.Gln103Pro)	LUZP4 (Q103P)	Single nucleotide variant (missense variant +1 more)	not specified	GUncertain significance
Select item 2467783	NM_016383.5(LUZP4):c.698G>A (p.Arg233His)	LUZP4 (R151H +1 more)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2460454	NM_016383.5(LUZP4):c.870G>C (p.Gln290His)	LUZP4 (Q290H +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2350655	NM_016383.5(LUZP4):c.362A>G (p.Tyr121Cys)	LUZP4 (Y39C +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2309908	NM_016383.5(LUZP4):c.193T>C (p.Ser65Pro)	LUZP4 (S65P)	Single nucleotide variant (synonymous variant +1 more)	not specified	GUncertain significance
Select item 2301715	NM_016383.5(LUZP4):c.750A>T (p.Arg250Ser)	LUZP4 (R250S +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2237083	NM_016383.5(LUZP4):c.161A>G (p.His54Arg)	LUZP4 (H54R +1 more)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2205924	NM_016383.5(LUZP4):c.218G>A (p.Arg73Gln)	LUZP4 (R73Q +1 more)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 1808673	GRCh37/hg19 Xq21.33-24(chrX:93805850-118913329)x1	ACSL4, AGTR2 +133 more	Copy number loss	not provided	GPathogenic
Select item 1710513	GRCh37/hg19 Xq21.1-24(chrX:76794355-119282836)x3	CAPN6, CENPI +176 more	Copy number gain	not provided	GPathogenic
Select item 1707442	GRCh37/hg19 Xp22.2-q28(chrX:11522765-155233731)x1	ABCB7, ABCD1 +790 more	Copy number loss	See cases	GPathogenic
Select item 1706520	GRCh37/hg19 Xq21.1-28(chrX:77670699-155233731)x1	NXF5, NXT2 +414 more	Copy number loss	See cases	GPathogenic
Select item 1704345	GRCh37/hg19 Xp22.33-q28(chrX:61545-155226048)x2	ABCB7, ABCD1 +818 more	Copy number gain	Klinefelter syndrome	GPathogenic
Select item 1703584	GRCh37/hg19 Xq11.1-28(chrX:62685885-155233731)	ABCB7, ABCD1 +501 more	Copy number loss	Turner syndrome	GPathogenic
Select item 1703580	GRCh37/hg19 Xp22.33-q28(chrX:1-155270560)	ABCB7, ABCD1 +819 more	Copy number loss	Turner syndrome	GPathogenic
Select item 1703579	GRCh37/hg19 Xp22.33-q28(chrX:1-155270560)	AKAP14, CT47A11 +819 more	Copy number gain	Hypotonia +2 more	GPathogenic
Select item 1526834	GRCh37/hg19 Xq22.1-24(chrX:101982475-116885339)	ACSL4, AGTR2 +77 more	Copy number gain	not specified	GPathogenic
Select item 1341233	GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x1	RADX, RAI2 +818 more	Copy number loss	not provided	GPathogenic
Select item 1341223	GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x3	GPM6B, KLHL15 +818 more	Copy number gain	not provided	GPathogenic
Select item 1180551	GRCh37/hg19 Xp22.33-q28(chrX:60000-155234966)x1	KLHL34, KLHL4 +818 more	Copy number loss	not provided	GPathogenic
Select item 992648	GRCh37/hg19 Xp11.21-q28(chrX:56469080-155233731)x3	CPXCR1, GABRE +509 more	Copy number gain	not provided	GPathogenic
Select item 983156	GRCh37/hg19 Xp11.21-q28(chrX:55507789-155198481)x3	ARMCX4, CXorf51B +513 more	Copy number gain	See cases	GPathogenic
Select item 979836	GRCh37/hg19 Xq21.33-28(chrX:94264404-155233731)x1	ABCD1, ACSL4 +387 more	Copy number loss	not provided	GPathogenic
Select item 979829	GRCh37/hg19 Xq21.1-25(chrX:77514079-127770854)x1	ACSL4, ACTRT1 +201 more	Copy number loss	not provided	GPathogenic
Select item 870781	NM_016383.5(LUZP4):c.487C>T (p.Arg163Ter)	LUZP4 (R163* +1 more)	Single nucleotide variant (nonsense)	not provided	GUncertain significance
Select item 816368	GRCh37/hg19 Xq21.1-28(chrX:84387417-155233731)x1	ABCD1, ACSL4 +398 more	Copy number loss	not provided	GPathogenic
Select item 816364	GRCh37/hg19 Xq21.1-28(chrX:78444738-155233731)x1	ABCD1, ACSL4 +410 more	Copy number loss	not provided	GPathogenic
Select item 777824	NM_016383.5(LUZP4):c.456A>G (p.Gln152=)	LUZP4	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 688137	GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x1	ARHGAP36, ARHGAP4 +818 more	Copy number loss	not provided	GPathogenic
Select item 687519	GRCh37/hg19 Xp11.21-q28(chrX:54941868-155233731)x1	AWAT1, AWAT2 +524 more	Copy number loss	not provided	GUncertain significance
Select item 686250	GRCh37/hg19 Xq22.3-28(chrX:104098124-155233731)x1	ABCD1, ACSL4 +320 more	Copy number loss	not provided	GPathogenic
Select item 685566	GRCh37/hg19 Xp11.1-q28(chrX:58455352-155233731)x1	AWAT2, BCAP31 +502 more	Copy number loss	not provided	GPathogenic
Select item 685331	GRCh37/hg19 Xp22.33-q28(chrX:168546-155233731)x4	BEX1, BEX2 +818 more	Copy number gain	not provided	GPathogenic
Select item 684964	GRCh37/hg19 Xq21.32-28(chrX:92814516-155233731)x1	AIFM1, CXorf51A +389 more	Copy number loss	not provided	GPathogenic
Select item 626291	Single allele	AKAP14, CCDC22 +733 more	Duplication	Syndromic X-linked intellectual disability Lubs type	GPathogenic
Select item 625796	GRCh37/hg19 Xq23(chrX:113097589-114931342)	MIR448, PLS3 +5 more	Copy number loss	Bone mineral density quantitative trait locus 18	GPathogenic
Select item 564884	GRCh37/hg19 Xq22.3-28(chrX:107823442-155233731)x1	FMR1-AS1, FMR1NB +297 more	Copy number loss	not provided	GPathogenic
Select item 564874	GRCh37/hg19 Xq22.1-28(chrX:99324651-155233731)x1	ABCD1, ACSL4 +385 more	Copy number loss	not provided	GPathogenic
Select item 564868	GRCh37/hg19 Xq21.31-28(chrX:91140025-155233731)x1	ABCD1, ACSL4 +390 more	Copy number loss	not provided	GPathogenic
Select item 545551	NC_000023.10:g.36649710_136649711del100000002insG	AMER1, AMMECR1 +541 more	Indel	Heterotaxy, visceral, 1, X-linked	GPathogenic
Select item 488014	Single allele	ARSF, CFAP47 +2632 more	Duplication	Autism +1 more	GPathogenic
Select item 443974	GRCh37/hg19 Xp22.33-q28(chrX:168547-155233731)	ABCB7, ABCD1 +818 more	Copy number gain	See cases	GPathogenic
Select item 443630	GRCh37/hg19 Xq23-28(chrX:112474054-155233731)x1	LRCH2, LUZP4 +277 more	Copy number loss	See cases	GPathogenic
Select item 443504	GRCh37/hg19 Xp21.2-q28(chrX:31088082-155233731)x1	PNMA5, PNMA6A +695 more	Copy number loss	See cases	GPathogenic
Select item 443017	GRCh37/hg19 Xp11.21-q28(chrX:56457791-155233731)x3	NAA10, NALF2 +509 more	Copy number gain	See cases	GPathogenic
Select item 442945	GRCh37/hg19 Xq21.1-28(chrX:78230501-155233731)x1	ABCD1, ACSL4 +410 more	Copy number loss	See cases	GPathogenic
Select item 442821	GRCh37/hg19 Xq21.33-28(chrX:96499476-151870013)x3	ACSL4, ACTRT1 +303 more	Copy number gain	See cases	GUncertain significance
Select item 442724	GRCh37/hg19 Xp22.33-q28(chrX:168547-151304063)x1	AP1S2, APEX2 +731 more	Copy number loss	See cases	GPathogenic
Select item 442712	GRCh37/hg19 Xq22.1-28(chrX:98495811-155233731)x1	ABCD1, ACSL4 +384 more	Copy number loss	See cases	GPathogenic
Select item 442646	GRCh37/hg19 Xp11.21-q28(chrX:57415659-155233731)x3	OR13H1, OTUD6A +505 more	Copy number gain	See cases	GPathogenic
Select item 442531	GRCh37/hg19 Xp11.21-q28(chrX:55000501-155230750)x3	ABCB7, ABCD1 +523 more	Copy number gain	See cases	GPathogenic
Select item 442422	GRCh37/hg19 Xq21.31-28(chrX:86900388-155233731)x1	ATP11C, ATP1B4 +393 more	Copy number loss	See cases	GPathogenic
Select item 442321	GRCh37/hg19 Xp11.21-q28(chrX:57511767-155233731)x3	YIPF6, ZBTB33 +505 more	Copy number gain	See cases	GPathogenic
Select item 442292	GRCh37/hg19 Xq23-24(chrX:111149921-117993284)x3	AGTR2, AMOT +18 more	Copy number gain	See cases	GLikely pathogenic
Select item 442001	GRCh37/hg19 Xq21.1-28(chrX:79862302-155233731)x1	ABCD1, ACSL4 +406 more	Copy number loss	See cases	GPathogenic
Select item 441843	GRCh37/hg19 Xq13.3-24(chrX:74560735-116609286)	PLP1, PLS3 +158 more	Copy number loss	See cases	GPathogenic
Select item 425520	GRCh37/hg19 Xp22.2-q25(chrX:11692290-121187337)x2	BEX4, BEX5 +566 more	Copy number gain	not provided	GUncertain significance
Select item 395718	GRCh37/hg19 Xp22.33-q28(chrX:70297-155246585)x1	TMLHE, TMSB15A +819 more	Copy number loss	See cases	GPathogenic
Select item 395687	GRCh37/hg19 Xp22.33-q28(chrX:70297-155255792)	ABCB7, ABCD1 +819 more	Copy number loss	See cases	GPathogenic
Select item 395686	GRCh37/hg19 Xp22.33-q28(chrX:70297-155255792)x4	BEX1, BEX2 +819 more	Copy number gain	See cases	GPathogenic
Select item 395246	GRCh37/hg19 Xq21.33-28(chrX:94043221-155246585)x1	ABCD1, ACSL4 +387 more	Copy number loss	See cases	GPathogenic
Select item 395066	GRCh37/hg19 Xq22.3-28(chrX:105694656-155224707)x1	ABCD1, ACSL4 +314 more	Copy number loss	See cases	GPathogenic
Select item 394846	GRCh37/hg19 Xq21.33-26.1(chrX:95498487-129063677)x3	ACSL4, ACTRT1 +180 more	Copy number gain	See cases	GPathogenic
Select item 394706	GRCh37/hg19 Xp22.33-q28(chrX:60701-155246225)x3	ABCB7, ABCD1 +819 more	Copy number gain	See cases	GPathogenic
Select item 394672	GRCh37/hg19 Xp22.33-q28(chrX:318707-155224707)x1	ABCB7, ADGRG2 +818 more	Copy number loss	See cases	GPathogenic
Select item 394066	GRCh37/hg19 Xq13.2-27.1(chrX:72224362-139262228)x4	TCEAL8, TCEAL9 +299 more	Copy number gain	See cases	GPathogenic
Select item 394013	GRCh37/hg19 Xp22.33-q28(chrX:71267-155255792)x1	ABCB7, ABCD1 +819 more	Copy number loss	See cases	GPathogenic
Select item 253652	GRCh37/hg19 Xp22.33-q28(chrX:71267-155246643)x3	ABCB7, ABCD1 +819 more	Copy number gain	See cases	GPathogenic

<< First< Prev

Page of 2