ClinVar for Gene (Select 3713) - ClinVar

Warning: The NCBI web site requires JavaScript to function. more...

Links from Gene

Items: 90

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 3341571	NM_005547.4(IVL):c.738T>A (p.Ser246=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 3287080	NM_005547.4(IVL):c.646C>T (p.Pro216Ser)	IVL (P216S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3287079	NM_005547.4(IVL):c.55C>A (p.Leu19Ile)	IVL (L19I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3287078	NM_005547.4(IVL):c.673C>A (p.Leu225Ile)	IVL (L225I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3287077	NM_005547.4(IVL):c.602G>A (p.Gly201Glu)	IVL (G201E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3287076	NM_005547.4(IVL):c.696G>T (p.Gln232His)	IVL (Q232H)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3287075	NM_005547.4(IVL):c.1733T>C (p.Val578Ala)	IVL (V578A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112035	NM_005547.4(IVL):c.967C>T (p.Pro323Ser)	IVL (P323S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112034	NM_005547.4(IVL):c.88C>A (p.His30Asn)	IVL (H30N)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112033	NM_005547.4(IVL):c.86C>G (p.Thr29Ser)	IVL (T29S)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112032	NM_005547.4(IVL):c.868G>A (p.Glu290Lys)	IVL (E290K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112030	NM_005547.4(IVL):c.529G>C (p.Glu177Gln)	IVL (E177Q)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112029	NM_005547.4(IVL):c.487C>G (p.Leu163Val)	IVL (L163V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112028	NM_005547.4(IVL):c.181G>A (p.Glu61Lys)	IVL (E61K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112027	NM_005547.4(IVL):c.1714C>G (p.Gln572Glu)	IVL (Q572E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112026	NM_005547.4(IVL):c.1570G>A (p.Glu524Lys)	IVL (E524K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112024	NM_005547.4(IVL):c.1186C>G (p.Leu396Val)	IVL (L396V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112023	NM_005547.4(IVL):c.1165G>A (p.Glu389Lys)	IVL (E389K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3112022	NM_005547.4(IVL):c.1148C>T (p.Pro383Leu)	IVL (P383L)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 3112021	NM_005547.4(IVL):c.1108G>T (p.Val370Leu)	IVL (V370L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 3063532	GRCh37/hg19 1q21.1-23.1(chr1:146577511-157155587)x3	ACP6, ADAM15 +263 more	Copy number gain	not specified	GPathogenic
Select item 3062988	GRCh37/hg19 1q21.1-23.1(chr1:144368497-158992086)x3	ACP6, ADAM15 +315 more	Copy number gain	not specified	GPathogenic
Select item 2799180	NM_005547.4(IVL):c.723GCAGCTGGAGCTCTCTGAGCAGCAGGAGGG[3] (p.Leu263_Lys264insGluLeuSerGluGlnGlnGluGlyGlnLeu)	IVL	Microsatellite (inframe_insertion)	not provided	GBenign
Select item 2681342	NM_005547.4(IVL):c.1243C>T (p.Gln415Ter)	IVL (Q415*)	Single nucleotide variant (nonsense)	EBV-positive nodal T- and NK-cell lymphoma	GLikely benign
Select item 2639344	NM_005547.4(IVL):c.1677G>A (p.Leu559=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2639343	NM_005547.4(IVL):c.528G>A (p.Pro176=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2639342	NM_005547.4(IVL):c.513A>G (p.Gly171=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2614617	NM_005547.4(IVL):c.1670C>A (p.Pro557Gln)	IVL (P557Q)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2580317	GRCh37/hg19 1q12-23.1(chr1:142535935-157648813)x3	ACP6, ADAM15 +293 more	Copy number gain	Chromosome 1q21.1 duplication syndrome	GPathogenic
Select item 2566049	NM_005547.4(IVL):c.1552G>A (p.Gly518Arg)	IVL (G518R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2544208	NM_005547.4(IVL):c.1499C>G (p.Pro500Arg)	IVL (P500R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2541536	NM_005547.4(IVL):c.1214A>G (p.His405Arg)	IVL (H405R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2525810	NM_005547.4(IVL):c.1075C>G (p.Gln359Glu)	IVL (Q359E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2524025	NM_005547.4(IVL):c.1026G>C (p.Gln342His)	IVL (Q342H)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2458165	NM_005547.4(IVL):c.1537C>G (p.Pro513Ala)	IVL (P513A)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2406099	NM_005547.4(IVL):c.1408C>G (p.Leu470Val)	IVL (L470V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2402535	NM_005547.4(IVL):c.1300G>A (p.Glu434Lys)	IVL (E434K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2399819	NM_005547.4(IVL):c.1414C>T (p.Leu472Phe)	IVL (L472F)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2397991	NM_005547.4(IVL):c.1306C>G (p.Gln436Glu)	IVL (Q436E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2396009	NM_005547.4(IVL):c.1229A>T (p.Glu410Val)	IVL (E410V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2391210	NM_005547.4(IVL):c.1516C>G (p.Gln506Glu)	IVL (Q506E)	Single nucleotide variant (missense variant)	not specified	GLikely benign
Select item 2375386	NM_005547.4(IVL):c.1353G>T (p.Glu451Asp)	IVL (E451D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2371618	NM_005547.4(IVL):c.1174C>A (p.Gln392Lys)	IVL (Q392K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2366288	NM_005547.4(IVL):c.1750C>T (p.His584Tyr)	IVL (H584Y)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2362037	NM_005547.4(IVL):c.527C>T (p.Pro176Leu)	IVL (P176L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2361878	NM_005547.4(IVL):c.968C>G (p.Pro323Arg)	IVL (P323R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2359938	NM_005547.4(IVL):c.494A>T (p.His165Leu)	IVL (H165L)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2354543	NM_005547.4(IVL):c.991G>A (p.Gly331Arg)	IVL (G331R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2325032	NM_005547.4(IVL):c.856C>A (p.Leu286Met)	IVL (L286M)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2296703	NM_005547.4(IVL):c.730G>C (p.Glu244Gln)	IVL (E244Q)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2276597	NM_005547.4(IVL):c.624G>T (p.Gln208His)	IVL (Q208H)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2268072	NM_005547.4(IVL):c.1172G>A (p.Gly391Glu)	IVL (G391E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2265426	NM_005547.4(IVL):c.576G>T (p.Gln192His)	IVL (Q192H)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2265376	NM_005547.4(IVL):c.401T>A (p.Leu134Gln)	IVL (L134Q)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2263023	NM_005547.4(IVL):c.814C>A (p.Gln272Lys)	IVL (Q272K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2256150	NM_005547.4(IVL):c.727C>G (p.Leu243Val)	IVL (L243V)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2256019	NM_005547.4(IVL):c.150G>T (p.Glu50Asp)	IVL (E50D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2247925	NM_005547.4(IVL):c.1282G>A (p.Gly428Arg)	IVL (G428R)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2243269	NM_005547.4(IVL):c.951G>T (p.Glu317Asp)	IVL (E317D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2243100	NM_005547.4(IVL):c.150G>C (p.Glu50Asp)	IVL (E50D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2237203	NM_005547.4(IVL):c.587C>T (p.Pro196Leu)	IVL (P196L)	Single nucleotide variant (missense variant)	not provided +1 more	GLikely benign
Select item 2233066	NM_005547.4(IVL):c.1249G>A (p.Glu417Lys)	IVL (E417K)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2227321	NM_005547.4(IVL):c.1710G>T (p.Glu570Asp)	IVL (E570D)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2226871	NM_005547.4(IVL):c.655C>G (p.Gln219Glu)	IVL (Q219E)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 2204352	NM_005547.4(IVL):c.29C>T (p.Thr10Ile)	IVL (T10I)	Single nucleotide variant (missense variant)	not specified	GUncertain significance
Select item 1809281	GRCh37/hg19 1q21.3(chr1:152648864-153286218)x3	C1orf68, IVL +27 more	Copy number gain	not provided	GUncertain significance
Select item 1445481	NC_000001.10:g.(?_149895434)_(156851434_?)dup	YY1AP1, CRCT1 +228 more	Duplication	MHC class II deficiency +3 more	GUncertain significance
Select item 1003645	NC_000001.10:g.(?_130980840)_(248900000_?)dup	FCGR3A, LCE3C +956 more	Duplication	Parathyroid carcinoma +2 more	GUncertain significance
Select item 775604	NM_005547.4(IVL):c.1348T>A (p.Leu450Met)	IVL (L450M)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 775603	NM_005547.4(IVL):c.1347G>A (p.Gln449=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 775602	NM_005547.4(IVL):c.763C>T (p.Leu255Phe)	IVL (L255F)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 775601	NM_005547.4(IVL):c.538G>A (p.Glu180Lys)	IVL (E180K)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 773814	NM_005547.4(IVL):c.513_542del (p.Lys174_Leu183del)	IVL	Deletion (inframe_deletion)	not provided	GLikely benign
Select item 769534	NM_005547.4(IVL):c.1513C>G (p.Gln505Glu)	IVL (Q505E)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 769533	NM_005547.4(IVL):c.709C>G (p.Gln237Glu)	IVL (Q237E)	Single nucleotide variant (missense variant)	not provided	GBenign
Select item 764655	NM_005547.4(IVL):c.957G>A (p.Gln319=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 758687	NM_005547.4(IVL):c.1209G>A (p.Leu403=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 753754	NM_005547.4(IVL):c.933G>A (p.Gly311=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 729085	NM_005547.4(IVL):c.1374G>A (p.Gly458=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 724720	NM_005547.4(IVL):c.633G>A (p.Gly211=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 722173	NM_005547.4(IVL):c.375A>G (p.Glu125=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 720995	NM_005547.4(IVL):c.492G>A (p.Lys164=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 720547	NM_005547.4(IVL):c.1044G>T (p.Gln348His)	IVL (Q348H)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 720546	NM_005547.4(IVL):c.882G>T (p.Lys294Asn)	IVL (K294N)	Single nucleotide variant (missense variant)	not provided	GLikely benign
Select item 720545	NM_005547.4(IVL):c.864G>A (p.Gln288=)	IVL	Single nucleotide variant (synonymous variant)	not provided	GBenign
Select item 565180	GRCh37/hg19 1q21.3(chr1:150853044-154647786)x3	LCE2A, S100A2 +125 more	Copy number gain	not provided	GPathogenic
Select item 442387	GRCh37/hg19 1p36.33-q44(chr1:849467-249224684)	CD34, CD46 +2014 more	Copy number gain	See cases	GPathogenic
Select item 442386	GRCh37/hg19 1p36.33-q44(chr1:849467-249224684)x3	GPATCH2, GPATCH3 +2014 more	Copy number gain	See cases	GPathogenic
Select item 225520	GRCh37/hg19 1q21.1-21.3(chr1:144927578-153223600)x3	CIART, LCE2A +154 more	Copy number gain	Chromosome 1q21.1 duplication syndrome	GPathogenic
Select item 155448	GRCh38/hg38 1q21.2-25.2(chr1:149854269-180267197)x3	LOC129931453, LOC129931454 +1585 more	Copy number gain	See cases	GPathogenic

ClinVar

Result Filters

Classification type

Germline classification

Types of conflicts

Molecular consequence

Variation type

Variation size

Variant length

Review status

Additional filters

Links from Gene

Items: 90