ClinVar for Gene (Select 109611589) - ClinVar

Links from Gene

Items: 97

	Variation	Gene (Protein Change)	Type (Consequence)	Condition	Classification, Review status
Select item 3157203	NM_001024630.4(RUNX2):c.236C>T (p.Ala79Val)	LOC109611589, RUNX2 (A65V +1 more)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 3157202	NM_001024630.4(RUNX2):c.218C>A (p.Ala73Glu)	LOC109611589, RUNX2 (A59E +1 more)	Single nucleotide variant (missense variant)	Inborn genetic diseases	GUncertain significance
Select item 3056647	NM_001024630.4(RUNX2):c.234GGC[4] (p.Ala89del)	LOC109611589, RUNX2 (A75del +1 more)	Microsatellite (inframe_indel)	RUNX2-related disorder	GLikely benign
Select item 3056020	NM_001024630.4(RUNX2):c.177GCA[5] (p.Gln71del)	LOC109611589, RUNX2 (Q57del +1 more)	Microsatellite (inframe_indel)	RUNX2-related disorder	GLikely benign
Select item 3017746	NM_001024630.4(RUNX2):c.174_209del (p.Gln60_Gln71del)	LOC109611589, RUNX2	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 3000008	NM_001024630.4(RUNX2):c.231_254dup (p.Ala89_Val90insAlaAlaAlaAlaAlaAlaAlaAla)	LOC109611589, RUNX2	Duplication (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2988054	NM_001024630.4(RUNX2):c.210G>T (p.Gln70His)	LOC109611589, RUNX2 (Q56H +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2963644	NM_001024630.4(RUNX2):c.261_263dup (p.Ala89_Val90insAla)	LOC109611589, RUNX2	Duplication (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2903269	NM_001024630.4(RUNX2):c.212AGG[3] (p.Glu72_Ala73insGlu)	LOC109611589, RUNX2	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2885780	NM_001024630.4(RUNX2):c.249T>G (p.Ala83=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2883924	NM_001024630.4(RUNX2):c.177GCA[9] (p.Gln71_Glu72insGlnGlnGln)	LOC109611589, RUNX2	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2859807	NM_001024630.4(RUNX2):c.205C>T (p.Gln69Ter)	LOC109611589, RUNX2 (Q55* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2820432	NM_001024630.4(RUNX2):c.177GCA[15] (p.Gln71_Glu72insGlnGlnGlnGlnGlnGlnGlnGlnGln)	LOC109611589, RUNX2	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2769121	NM_001024630.4(RUNX2):c.196CAG[4] (p.Gln70_Gln71del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2754949	NM_001024630.4(RUNX2):c.186G>A (p.Gln62=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2734875	NM_001024630.4(RUNX2):c.199C>T (p.Gln67Ter)	LOC109611589, RUNX2 (Q53* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2734874	NM_001024630.4(RUNX2):c.196C>T (p.Gln66Ter)	LOC109611589, RUNX2 (Q66* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2734873	NM_001024630.4(RUNX2):c.148C>T (p.Gln50Ter)	LOC109611589, RUNX2 (Q36* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2721787	NM_001024630.4(RUNX2):c.168_194dup (p.Gln71_Glu72insGlnGlnGlnGlnGlnGlnGlnGlnGln)	LOC109611589, RUNX2	Duplication (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2719910	NM_001024630.4(RUNX2):c.174_191del (p.Gln66_Gln71del)	LOC109611589, RUNX2	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2706950	NM_001024630.4(RUNX2):c.194_286del (p.Gln65_Pro95del)	LOC109611589, RUNX2	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2572649	NM_001024630.4(RUNX2):c.173_227del (p.Gln58fs)	LOC109611589, RUNX2 (Q44fs +1 more)	Deletion (frameshift variant)	Cleidocranial dysostosis	GLikely pathogenic
Select item 2430470	NM_001024630.4(RUNX2):c.238G>T (p.Ala80Ser)	LOC109611589, RUNX2 (A66S +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2189575	NM_001024630.4(RUNX2):c.193_231del (p.Gln65_Ala77del)	LOC109611589, RUNX2	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2189554	NM_001024630.4(RUNX2):c.153G>A (p.Gln51=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2179319	NM_001024630.4(RUNX2):c.159A>G (p.Gln53=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2165278	NM_001024630.4(RUNX2):c.231_239dup (p.Ala89_Val90insAlaAlaAla)	LOC109611589, RUNX2	Duplication (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2160044	NM_001024630.4(RUNX2):c.162GCA[5] (p.Gln71_Glu72insGln)	LOC109611589, RUNX2	Microsatellite (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 2136397	NM_001024630.4(RUNX2):c.190C>T (p.Gln64Ter)	LOC109611589, RUNX2 (Q50* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2089848	NM_001024630.4(RUNX2):c.187C>T (p.Gln63Ter)	LOC109611589, RUNX2 (Q49* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2088645	NM_001024630.4(RUNX2):c.231T>A (p.Ala77=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 2074477	NM_001024630.4(RUNX2):c.191A>G (p.Gln64Arg)	LOC109611589, RUNX2 (Q50R +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2060210	NM_001024630.4(RUNX2):c.233C>A (p.Ala78Glu)	LOC109611589, RUNX2 (A64E +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 2028746	NM_001024630.4(RUNX2):c.174_179del (p.Gln70_Gln71del)	LOC109611589, RUNX2	Deletion (inframe_deletion +1 more)	not provided	GUncertain significance
Select item 2020304	NM_001024630.4(RUNX2):c.163C>T (p.Gln55Ter)	LOC109611589, RUNX2 (Q55* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 2000427	NM_001024630.4(RUNX2):c.247G>T (p.Ala83Ser)	LOC109611589, RUNX2 (A83S +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1902215	NM_001024630.4(RUNX2):c.249_257dup (p.Ala89_Val90insAlaAlaAla)	LOC109611589, RUNX2	Duplication (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 1901227	NM_001024630.4(RUNX2):c.231_245dup (p.Ala89_Val90insAlaAlaAlaAlaAla)	LOC109611589, RUNX2	Duplication (inframe_insertion +1 more)	not provided	GUncertain significance
Select item 1576519	NM_001024630.4(RUNX2):c.219G>A (p.Ala73=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1563906	NM_001024630.4(RUNX2):c.228G>A (p.Ala76=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1534083	NM_001024630.4(RUNX2):c.225G>A (p.Ala75=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1534082	NM_001024630.4(RUNX2):c.222G>A (p.Ala74=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1534081	NM_001024630.4(RUNX2):c.210G>A (p.Gln70=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1521900	NM_001024630.4(RUNX2):c.228_248del (p.Ala83_Ala89del)	LOC109611589, RUNX2	Deletion (inframe_deletion)	not provided	GUncertain significance
Select item 1502799	NM_001024630.4(RUNX2):c.225GGCGGCTGCGGCGGCGGC[3] (p.Ala84_Ala89dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1496105	NM_001024630.4(RUNX2):c.234GGC[6] (p.Ala89dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1490475	NM_001024630.4(RUNX2):c.177GCA[11] (p.Gln67_Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1478949	NM_001024630.4(RUNX2):c.221C>A (p.Ala74Glu)	LOC109611589, RUNX2 (A60E +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1456832	NM_001024630.4(RUNX2):c.184C>T (p.Gln62Ter)	LOC109611589, RUNX2 (Q62* +1 more)	Single nucleotide variant (nonsense)	not provided	GPathogenic
Select item 1443625	NM_001024630.4(RUNX2):c.216G>C (p.Glu72Asp)	LOC109611589, RUNX2 (E72D +1 more)	Single nucleotide variant (missense variant)	not provided	GUncertain significance
Select item 1429898	NM_001024630.4(RUNX2):c.216GGC[7] (p.Ala88_Ala89dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1429046	NM_001024630.4(RUNX2):c.196CAG[7] (p.Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1414475	NM_001024630.4(RUNX2):c.216GGC[4] (p.Ala89del)	LOC109611589, RUNX2 (A75del +1 more)	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 1411304	NM_001024630.4(RUNX2):c.249_254dup (p.Ala88_Ala89dup)	LOC109611589, RUNX2	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 1408906	NM_001024630.4(RUNX2):c.234GGC[2] (p.Ala87_Ala89del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 1392475	NM_001024630.4(RUNX2):c.190_213del (p.Gln64_Gln71del)	LOC109611589, RUNX2	Deletion (inframe_deletion)	not provided	GUncertain significance
Select item 1377609	NM_001024630.4(RUNX2):c.246_260dup (p.Ala85_Ala89dup)	LOC109611589, RUNX2	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 1360365	NM_001024630.4(RUNX2):c.239_240insAGCGGCGGCTGCGGCGGC (p.Ala84_Ala89dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1351643	NM_001024630.4(RUNX2):c.231_236del (p.Ala88_Ala89del)	LOC109611589, RUNX2	Deletion (inframe_deletion)	not provided	GUncertain significance
Select item 1338512	NM_001024630.4(RUNX2):c.200_201insACAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAACAGCAG (p.Glu72fs)	LOC109611589, RUNX2 (E58fs +1 more)	Insertion (frameshift variant)	not provided	GPathogenic
Select item 1337138	NM_001024630.4(RUNX2):c.201G>A (p.Gln67=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not specified	GLikely benign
Select item 1329578	NM_001024630.4(RUNX2):c.174_185dup (p.Gln68_Gln71dup)	LOC109611589, RUNX2	Duplication (inframe_insertion)	not provided	GConflicting classifications of pathogenicity
Select item 1192123	NM_001024630.4(RUNX2):c.177GCA[7] (p.Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GConflicting classifications of pathogenicity
Select item 1135849	NM_001024630.4(RUNX2):c.222G>C (p.Ala74=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1132909	NM_001024630.4(RUNX2):c.174A>G (p.Gln58=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1128357	NM_001024630.4(RUNX2):c.177G>A (p.Gln59=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 1121355	NM_001024630.4(RUNX2):c.195A>G (p.Gln65=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided +1 more	GLikely benign
Select item 1062153	NM_001024630.4(RUNX2):c.147ACAGCAGCAGCA[1] (p.Gln68_Gln71del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 1059365	NM_001024630.4(RUNX2):c.228_260dup (p.Ala79_Ala89dup)	LOC109611589, RUNX2	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 1056240	NM_001024630.4(RUNX2):c.195_209dup (p.Gln67_Gln71dup)	LOC109611589, RUNX2	Duplication (inframe_insertion)	not provided	GUncertain significance
Select item 1036921	NM_001024630.4(RUNX2):c.177GCA[8] (p.Gln70_Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 1022116	NM_001024630.4(RUNX2):c.199_200del (p.Gln67fs)	LOC109611589, RUNX2 (Q53fs +1 more)	Deletion (frameshift variant)	not provided	GUncertain significance
Select item 1010237	NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[3] (p.Gln65_Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 994177	NM_001024630.4(RUNX2):c.219G>T (p.Ala73=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	not provided	GLikely benign
Select item 976311	NM_001024630.4(RUNX2):c.211C>T (p.Gln71Ter)	LOC109611589, RUNX2 (Q57* +1 more)	Single nucleotide variant (nonsense)	not provided +1 more	GLikely pathogenic
Select item 916702	NM_001024630.4(RUNX2):c.203delinsCG (p.Gln68fs)	LOC109611589, RUNX2 (Q54fs +1 more)	Indel (frameshift variant)	Cleidocranial dysostosis	GLikely pathogenic
Select item 911153	NM_001024630.4(RUNX2):c.176A>G (p.Gln59Arg)	LOC109611589, RUNX2 (Q45R +1 more)	Single nucleotide variant (missense variant)	Cleidocranial dysostosis +1 more	GConflicting classifications of pathogenicity
Select item 859144	NM_001024630.4(RUNX2):c.216GGC[6] (p.Ala89dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	not provided	GUncertain significance
Select item 845536	NM_001024630.4(RUNX2):c.159ACAGCAGCAGCAGCA[1] (p.Gln67_Gln71del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion)	not provided	GUncertain significance
Select item 548612	NM_001024630.4(RUNX2):c.217del (p.Ala73fs)	LOC109611589, RUNX2 (A59fs +1 more)	Deletion (frameshift variant)	Metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome +1 more	GConflicting classifications of pathogenicity
Select item 548611	NM_001024630.4(RUNX2):c.233_234insAGGA (p.Ala79fs)	LOC109611589, RUNX2 (A79fs +1 more)	Insertion (frameshift variant)	Metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome +1 more	GUncertain significance
Select item 548496	NM_001024630.4(RUNX2):c.159ACAGCAGCAGCAGCA[3] (p.Gln67_Gln71dup)	LOC109611589, RUNX2	Microsatellite (inframe_insertion)	Cleidocranial dysostosis +1 more	GUncertain significance
Select item 500283	NM_001024630.4(RUNX2):c.151C>A (p.Gln51Lys)	LOC109611589, RUNX2 (Q51K +1 more)	Single nucleotide variant (missense variant)	not specified +1 more	GConflicting classifications of pathogenicity
Select item 497059	NM_001024630.4(RUNX2):c.159_185del (p.Gln63_Gln71del)	LOC109611589, RUNX2	Deletion (inframe_deletion)	not specified	GLikely benign
Select item 376847	NM_001024630.4(RUNX2):c.254C>T (p.Ala85Val)	LOC109611589, RUNX2 (A85V +1 more)	Single nucleotide variant (missense variant)	not provided +1 more	GBenign/Likely benign
Select item 357090	NM_001024630.4(RUNX2):c.234G>A (p.Ala78=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	Cleidocranial dysostosis	GLikely benign
Select item 257095	NM_001024630.4(RUNX2):c.225GGCGGCTGCGGCGGCGGC[1] (p.Ala84_Ala89del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion)	not specified +2 more	GBenign/Likely benign
Select item 196302	NM_001024630.4(RUNX2):c.172CAACAGCAGCAGCAGCAGCAG[1] (p.Gln65_Gln71del)	LOC109611589, RUNX2	Microsatellite (inframe_deletion)	not specified +1 more	GConflicting classifications of pathogenicity
Select item 196301	NM_001024630.4(RUNX2):c.240G>A (p.Ala80=)	LOC109611589, RUNX2	Single nucleotide variant (synonymous variant)	Cleidocranial dysostosis +2 more	GBenign
Select item 155430	GRCh38/hg38 6p25.3-12.3(chr6:156974-46789291)x3	ILRUN-AS1, IP6K3 +2582 more	Copy number gain	See cases	GPathogenic
Select item 146275	GRCh38/hg38 6p21.1-12.3(chr6:44985760-47986838)x3	ADGRF1, ADGRF2 +78 more	Copy number gain	See cases	GLikely pathogenic
Select item 59500	GRCh38/hg38 6p21.1(chr6:44993452-46061865)x3	CLIC5, LOC109611589 +22 more	Copy number gain	See cases	GUncertain significance
Select item 58428	GRCh38/hg38 6p21.1-12.3(chr6:41638061-46512949)x1	LOC132089395, LOC132089396 +324 more	Copy number loss	See cases	GPathogenic
Select item 58427	GRCh38/hg38 6p21.2-21.1(chr6:37777369-45653843)x1	LOC129996415, LOC129996416 +435 more	Copy number loss	See cases	GPathogenic
Select item 40202	NC_000006.12:g.45341183_45446148dup	LOC109611589, LOC129996578 +2 more	Duplication	Metaphyseal dysplasia-maxillary hypoplasia-brachydacty syndrome	GPathogenic
Select item 9297	NM_001024630.4(RUNX2):c.231_260dup (p.Ala80_Ala89dup)	LOC109611589, RUNX2	Duplication (inframe_insertion)	Cleidocranial dysplasia 1, forme fruste, with brachydactyly	GPathogenic
Select item 9295	NM_001024630.4(RUNX2):c.189_203delinsACAGCAGCAGCAGCAGCAGCAACAGCAGCCG (p.Glu72fs)	LOC109611589, RUNX2 (E72fs +1 more)	Indel (frameshift variant)	Cleidocranial dysostosis	GPathogenic

ClinVar

Result Filters

Classification type

Germline classification

Types of conflicts

Molecular consequence

Variation type

Variation size

Variant length

Review status

Additional filters

Links from Gene

Items: 97