VCV000008627.5 - ClinVar

NM_020547.3(AMHR2):c.1332_1358del (p.Gly445_Leu453del)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(3)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_020547.3(AMHR2):c.1332_1358del (p.Gly445_Leu453del)

Variation ID: 8627 Accession: VCV000008627.5

Type and length

Deletion, 27 bp

Location

Cytogenetic: 12q13.13 12: 53430187-53430213 (GRCh38) [ NCBI UCSC ] 12: 53823971-53823997 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Apr 4, 2013	Feb 14, 2024	Nov 1, 2022

HGVS

Nucleotide	Protein	Molecular consequence
NM_020547.3:c.1332_1358del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_065434.1:p.Gly445_Leu453del	inframe deletion
NM_001164690.2:c.1328_1354del	NP_001158162.1:p.Trp443_Ser451del	inframe deletion
NM_001164691.2:c.1140+564_1140+590del		intron variant
NC_000012.12:g.53430189_53430215del
NC_000012.11:g.53823973_53823999del
NG_015981.1:g.11335_11361del

... more HGVS ... less HGVS

Protein change

Other names

Canonical SPDI

NC_000012.12:53430186:CTGGGCAATACCCCTACCTCTGATGAGCT:CT

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

OMIM: 600956.0002 dbSNP: rs764761319 VarSome

Comment on variant

NCBI staff provided an HGVS expression for allelic variant 600956.0002 from the sequence reported in Figure 3 of the paper by Imbeaud et al., 1996 (PubMed 8872466).

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
AMHR2		-	-	GRCh38 GRCh37	115	129

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Persistent mullerian duct syndrome, type II	Pathogenic (1)	no assertion criteria provided	Aug 15, 2009	RCV000009159.2
Persistent Mullerian duct syndrome	Pathogenic (1)	criteria provided, single submitter	-	RCV002286396.2
not provided	Pathogenic (1)	criteria provided, single submitter	Nov 1, 2022	RCV002512931.4

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Nov 01, 2022)	criteria provided, single submitter (Invitae Variant Classification Sherloc (09022015)) Method: clinical testing	not provided Affected status: unknown Allele origin: germline	Labcorp Genetics (formerly Invitae), Labcorp Accession: SCV003257616.2 First in ClinVar: Feb 07, 2023 Last updated: Feb 14, 2024	Publications: PubMed (3) PubMed: 19457927‚ 31291191‚ 8872466 Comment: For these reasons, this variant has been classified as Pathogenic. Experimental studies have shown that this variant affects AMHR2 function (PMID: 19457927, 31291191). Algorithms developed … (more) For these reasons, this variant has been classified as Pathogenic. Experimental studies have shown that this variant affects AMHR2 function (PMID: 19457927, 31291191). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. ClinVar contains an entry for this variant (Variation ID: 8627). This variant is also known as ‚àÜ27 bp, ‚àÜ6331- 6357, and del6331‚Äì6357. This variant has been observed in individuals with AMHR2-related conditions (PMID: 8872466). This variant is present in population databases (rs764761319, gnomAD 0.09%). This variant, c.1332_1358del, results in the deletion of 9 amino acid(s) of the AMHR2 protein (p.Gly445_Leu453del), but otherwise preserves the integrity of the reading frame. (less)
Pathogenic (-)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Persistent Mullerian duct syndrome Affected status: yes Allele origin: maternal	Equipe Genetique des Anomalies du Developpement, Université de Bourgogne Accession: SCV002576495.1 First in ClinVar: Oct 01, 2022 Last updated: Oct 01, 2022
Pathogenic (Aug 15, 2009)	no assertion criteria provided Method: literature only	PERSISTENT MULLERIAN DUCT SYNDROME, TYPE II Affected status: not provided Allele origin: germline	OMIM Accession: SCV000029376.1 First in ClinVar: Apr 04, 2013 Last updated: Apr 04, 2013	Publications: PubMed (2) PubMed: 8872466‚ 19457927 Comment on evidence: Imbeaud et al. (1996) detected a 27-bp deletion (6331_6357del) in exon 10 of the AMHR gene, on at least 1 allele in 10 of 16 … (more) Imbeaud et al. (1996) detected a 27-bp deletion (6331_6357del) in exon 10 of the AMHR gene, on at least 1 allele in 10 of 16 patients studied with AMHR mutations. The deletion was homozygous in 4 patients and was coupled with missense mutations in 6 patients. Belville et al. (2009) noted that the 6331_6357del is missing residues 444 to 452, which are located at the top of the C-lobe in the X region of the kinase domain. Molecular modeling predicted that the deletion should lead to a substantial conformational change in the AMHR2 fold, since the residues constitute part of the alpha-G helix and the loop that precedes it. (less)

Comment:

For these reasons, this variant has been classified as Pathogenic. Experimental studies have shown that this variant affects AMHR2 function (PMID: 19457927, 31291191). Algorithms developed to predict the effect of variants on protein structure and function are not available or were not evaluated for this variant. ClinVar contains an entry for this variant (Variation ID: 8627). This variant is also known as ‚àÜ27 bp, ‚àÜ6331- 6357, and del6331‚Äì6357. This variant has been observed in individuals with AMHR2-related conditions (PMID: 8872466). This variant is present in population databases (rs764761319, gnomAD 0.09%). This variant, c.1332_1358del, results in the deletion of 9 amino acid(s) of the AMHR2 protein (p.Gly445_Leu453del), but otherwise preserves the integrity of the reading frame.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Defective AMH signaling disrupts GnRH neuron development and function and contributes to hypogonadotropic hypogonadism.	Malone SA	eLife	2019	PMID: 31291191
Natural mutations of the anti-Mullerian hormone type II receptor found in persistent Mullerian duct syndrome affect ligand binding, signal transduction and cellular transport.	Belville C	Human molecular genetics	2009	PMID: 19457927
A 27 base-pair deletion of the anti-müllerian type II receptor gene is the most common cause of the persistent müllerian duct syndrome.	Imbeaud S	Human molecular genetics	1996	PMID: 8872466

Text-mined citations for rs764761319 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 29, 2024

ClinVar Genomic variation as it relates to human health

NM_020547.3(AMHR2):c.1332_1358del (p.Gly445_Leu453del)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs764761319 ...