ClinVar Genomic variation as it relates to human health
NM_022834.5(VWA1):c.62_71dup (p.Gly25fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_022834.5(VWA1):c.62_71dup (p.Gly25fs)
Variation ID: 830327 Accession: VCV000830327.20
- Type and length
-
Microsatellite, 10 bp
- Location
-
Cytogenetic: 1p36.33 1: 1435798-1435799 (GRCh38) [ NCBI UCSC ] 1: 1371178-1371179 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Aug 3, 2020 Aug 25, 2024 May 22, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_022834.5:c.62_71dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_073745.2:p.Gly25fs frameshift NM_022834.5:c.62_71dup10 MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
frameshift NM_022834.4:c.62_71dup10 NM_199121.3:c.62_71dup NP_954572.2:p.Gly25fs frameshift NC_000001.11:g.1435800GCGCGGAGCG[3] NC_000001.10:g.1371180GCGCGGAGCG[3] - Protein change
- G25fs
- Other names
- -
- Canonical SPDI
- NC_000001.11:1435798:GGCGCGGAGCGGCGCGGAGCG:GGCGCGGAGCGGCGCGGAGCGGCGCGGAGCG
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
VWA1 | - | - |
GRCh38 GRCh37 |
88 | 243 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (5) |
criteria provided, multiple submitters, no conflicts
|
May 22, 2024 | RCV001310232.13 | |
Likely pathogenic (1) |
no assertion criteria provided
|
Jan 1, 2020 | RCV001839418.10 | |
Pathogenic/Likely pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Mar 1, 2023 | RCV003222198.17 | |
VWA1-related disorder
|
Likely pathogenic (1) |
criteria provided, single submitter
|
Sep 16, 2022 | RCV003413814.4 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Apr 26, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Neuronopathy, distal hereditary motor, autosomal recessive 7
Affected status: unknown
Allele origin:
unknown
|
Fulgent Genetics, Fulgent Genetics
Accession: SCV002813987.1
First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022 |
|
|
Pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
Neuropathy, hereditary motor, with myopathic features
Affected status: yes
Allele origin:
germline
|
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego
Accession: SCV004046344.1
First in ClinVar: Oct 21, 2023 Last updated: Oct 21, 2023 |
Comment:
This frameshifting variant in exon 1 of 3 is predicted to result in loss of normal protein function through either protein truncation or nonsense-mediated mRNA … (more)
This frameshifting variant in exon 1 of 3 is predicted to result in loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay (NMD). This variant has been previously reported as a compound heterozygous or homozygous change in individuals with neuromyopathy (PMID: 33459760) and hereditary motor neuropathy (PMID: 33559681). The c.62_71dup (p.Gly25ArgfsTer74) variant is present in the heterozygous state in the gnomAD population database at a frequency of 0.0333% (15/45050) and thus is presumed to be rare. Based on the available evidence, the c.62_71dup (p.Gly25ArgfsTer74) variant is classified as Pathogenic. (less)
|
|
Likely pathogenic
(Sep 16, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
VWA1-related condition
Affected status: unknown
Allele origin:
germline
|
PreventionGenetics, part of Exact Sciences
Accession: SCV004118453.1
First in ClinVar: Nov 20, 2023 Last updated: Nov 20, 2023 |
Comment:
The VWA1 c.62_71dup10 variant is predicted to result in a frameshift and premature protein termination (p.Gly25Argfs*74). This variant has been reported in the compound heterozygous … (more)
The VWA1 c.62_71dup10 variant is predicted to result in a frameshift and premature protein termination (p.Gly25Argfs*74). This variant has been reported in the compound heterozygous and homozygous state in individuals from mutliple unrelated families with neuromyopathy (Deschauer et al 2021. PubMed ID: 33459760; Pagnamenta AT et al 2021. PubMed ID: 33559681). This variant is reported in 0.070% of alleles in individuals of African descent in gnomAD (http://gnomad.broadinstitute.org/variant/1-1371178-T-TGGCGCGGAGC). Frameshift variants in VWA1 are expected to be pathogenic. This variant is interpreted as likely pathogenic. (less)
|
|
Pathogenic
(May 22, 2024)
|
criteria provided, single submitter
Method: research
|
Neuronopathy, distal hereditary motor, autosomal recessive 7
(Autosomal recessive inheritance)
Affected status: yes
Allele origin:
germline
|
Neurogenomics Lab, Neuroscience Institute, University Of Cape Town
Study: International Center for Genomic Medicine for Neuromuscular Disease (ICGNMD).
Accession: SCV004171120.2 First in ClinVar: Dec 02, 2023 Last updated: May 26, 2024 |
Comment:
Sequencing funded by the International Centre for Genomic Medicine in Neuromuscular Diseases (ICGNMD): https://www.ucl.ac.uk/genomic-medicine-neuromuscular-diseases/.
Number of individuals with the variant: 1
Sex: male
Geographic origin: Zambia
Comment on evidence:
Proband also has the following heterozygous variant (not confirmed in trans): NM_022834.5:c.662dup (VWA1), NP_073745.2:p.Glu222GlyfsTer65.
|
|
Pathogenic
(Feb 05, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Neuronopathy, distal hereditary motor, autosomal recessive 7
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV005049489.1
First in ClinVar: Jun 09, 2024 Last updated: Jun 09, 2024 |
|
|
Pathogenic
(Mar 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV003916032.11
First in ClinVar: Apr 23, 2023 Last updated: Aug 04, 2024 |
Comment:
VWA1: PVS1, PM2, PM3
Number of individuals with the variant: 1
|
|
Likely pathogenic
(Jan 12, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
Clinical Genetics Laboratory, Skane University Hospital Lund
Accession: SCV005199021.1
First in ClinVar: Aug 25, 2024 Last updated: Aug 25, 2024 |
|
|
Likely pathogenic
(Jan 01, 2020)
|
no assertion criteria provided
Method: research
|
Neuromyopathy
Affected status: yes
Allele origin:
germline
|
Section for Clinical Neurogenetics, University of Tübingen
Accession: SCV001190597.1
First in ClinVar: Aug 03, 2020 Last updated: Aug 03, 2020 |
|
|
Pathogenic
(Oct 17, 2023)
|
no assertion criteria provided
Method: literature only
|
NEURONOPATHY, DISTAL HEREDITARY MOTOR, AUTOSOMAL RECESSIVE 7
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV001499846.2
First in ClinVar: Mar 07, 2021 Last updated: Oct 21, 2023 |
Comment on evidence:
In a 44-year-old German man, born of unrelated parents (F6), with autosomal recessive distal hereditary motor neuronopathy-7 (HMNR7; 619216), Deschauer et al. (2021) identified a … (more)
In a 44-year-old German man, born of unrelated parents (F6), with autosomal recessive distal hereditary motor neuronopathy-7 (HMNR7; 619216), Deschauer et al. (2021) identified a homozygous 10-bp duplication (c.62_71dup, NM_022834.4) in exon 1 of the VWA1 gene, predicted to result in a frameshift and premature termination (Gly25ArgfsTer74). Three patients from 2 additional families (F2 and F4) were compound heterozygous for c.62_71dup and another pathogenic variant. F2 carried a c.94C-T transition, resulting in an arg32-to-ter (R32X; 611901.0003) substitution on the other allele, whereas F4 carried a 1-bp deletion (c.879del), predicted to result in a frameshift and premature termination (Arg293SerfsTer58; 611901.0004) on the other allele. The mutations, which were found by exome sequencing and confirmed by Sanger sequencing, segregated with the disorder in the families. All were present in the heterozygous state at a low frequency in the gnomAD database, with c.62_71dup having the highest frequency (0.06%, v.3.0); no homozygous loss-of-function VWA1 variants were observed in gnomAD. The results were consistent with a loss-of-function effect, although functional studies of the variants were not performed. In affected members of 14 unrelated families of Caucasian or European descent with HMNR7, Pagnamenta et al. (2021) identified a 10-bp insertion (c.62_71dup10, NM_022834.5) in exon 1 of the VWA1 gene, predicted to result in a frameshift and premature termination. Ten families carried the mutation in the homozygous state, and the others were compound heterozygous for the allele in combination with another putatively pathogenic VWA1 allele. Fibroblasts derived from 1 patient showed reduced VWA1 transcript levels, consistent with partial nonsense-mediated mRNA decay, as well as absence of the VWA1 protein. The allele frequency in European populations approached 1 in 1,000, and haplotype analysis identified a shared region, consistent with a founder mutation arising over 7,000 years ago. Functional studies of the variant were not performed, but it was predicted to result in a loss of function. (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
The mutational profile in a South African cohort with inherited neuropathies and spastic paraplegia. | Mahungu AC | Frontiers in neurology | 2023 | PMID: 37712079 |
An ancestral 10-bp repeat expansion in VWA1 causes recessive hereditary motor neuropathy. | Pagnamenta AT | Brain : a journal of neurology | 2021 | PMID: 33559681 |
Bi-allelic truncating mutations in VWA1 cause neuromyopathy. | Deschauer M | Brain : a journal of neurology | 2021 | PMID: 33459760 |
Text-mined citations for rs749383814 ...
HelpRecord last updated Sep 08, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.