This recessive SPG7 variant was found in compound heterozygosity with one another recessive SPG7 variant in a female patient with spastic paraplegia 7
ClinVar Genomic variation as it relates to human health
NM_003119.4(SPG7):c.1049_1077del (p.Pro350fs)
Germline
Classification
Help
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
(9)
Help
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Pathogenic
9
criteria provided, multiple submitters, no conflicts
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Variant Details
This variant is part of a Genotype
- Identifiers
-
NM_003119.4(SPG7):c.1049_1077del (p.Pro350fs)
Variation ID: 495055 Accession: VCV000495055.43
- Type and length
-
Deletion, 29 bp
- Location
-
Cytogenetic: 16q24.3 16: 89598369-89598397 (GRCh37) [ NCBI UCSC ] 16: 89531961-89531989 (GRCh38) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Mar 4, 2018 Oct 26, 2024 Apr 23, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_003119.4:c.1049_1077del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_003110.1:p.Pro350fs frameshift NM_003119.4:c.1049_1077del29 MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NM_001363850.1:c.1049_1077del NP_001350779.1:p.Pro350fs frameshift NM_003119.2:c.1049_1077del NM_199367.3:c.1049_1077del NP_955399.1:p.Pro350fs frameshift NC_000016.10:g.89531965_89531993del NC_000016.9:g.89598373_89598401del NG_008082.1:g.28569_28597del - Protein change
- P350fs
- Other names
- -
- Canonical SPDI
- NC_000016.10:89531960:GGCCCCCCCGGCTGTGGGAAGACGCTGCTGGCC:GGCC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| SPG7 | - | - |
GRCh38 GRCh37 |
971 | 1143 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic (7) |
criteria provided, multiple submitters, no conflicts
|
Apr 23, 2024 | RCV000585677.16 | |
| Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Jun 1, 2023 | RCV000996406.24 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary spastic paraplegia 7
Affected status: yes
Allele origin:
unknown
|
Paris Brain Institute, Inserm - ICM
Accession: SCV001451042.1
First in ClinVar: May 16, 2021 Last updated: May 16, 2021 |
Number of individuals with the variant: 10
|
|
|
Pathogenic
(Aug 07, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary spastic paraplegia 7
Affected status: yes
Allele origin:
maternal
|
Center of Genomic medicine, Geneva, University Hospital of Geneva
Accession: SCV000693454.2
First in ClinVar: Mar 04, 2018 Last updated: Dec 11, 2022 |
Comment:
This recessive SPG7 variant was found in compound heterozygosity with one another recessive SPG7 variant in a female patient with spastic paraplegia 7
Age: 40-49 years
Sex: female
|
|
|
Pathogenic
(May 27, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary spastic paraplegia 7
Affected status: unknown
Allele origin:
unknown
|
Fulgent Genetics, Fulgent Genetics
Accession: SCV002811035.1
First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022 |
|
|
|
Pathogenic
(Aug 03, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV002577024.2
First in ClinVar: Oct 08, 2022 Last updated: Mar 04, 2023 |
Comment:
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not … (more)
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at a significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 23065789, 32816195) (less)
|
|
|
Pathogenic
(Nov 27, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary spastic paraplegia 7
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV001236166.6
First in ClinVar: Apr 15, 2020 Last updated: Feb 20, 2024 |
Comment:
This sequence change creates a premature translational stop signal (p.Pro350Glnfs*36) in the SPG7 gene. It is expected to result in an absent or disrupted protein … (more)
This sequence change creates a premature translational stop signal (p.Pro350Glnfs*36) in the SPG7 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SPG7 are known to be pathogenic (PMID: 21623769, 22964162). This variant is present in population databases (rs775364547, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with hereditary spastic paraplegia (PMID: 23065789; Invitae). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 495055). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
|
Pathogenic
(Jun 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV001151093.27
First in ClinVar: Feb 03, 2020 Last updated: Oct 20, 2024 |
Comment:
SPG7: PVS1, PM3:Strong, PM2
Number of individuals with the variant: 6
|
|
|
Pathogenic
(Jan 01, 2022)
|
criteria provided, single submitter
Method: research
|
Hereditary spastic paraplegia 7
Affected status: yes
Allele origin:
germline
|
PROSPAX: an integrated multimodal progression chart in spastic ataxias, Center for Neurology; Hertie-Institute for Clinical Brain Research
Accession: SCV005044593.1
First in ClinVar: Oct 20, 2024 Last updated: Oct 20, 2024 |
Number of individuals with the variant: 1
|
|
|
Pathogenic
(Apr 23, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Hereditary spastic paraplegia 7
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV005076647.1
First in ClinVar: Jul 15, 2024 Last updated: Jul 15, 2024 |
Comment:
Variant summary: SPG7 c.1049_1077del29 (p.Pro350GlnfsX36) results in a premature termination codon, predicted to cause absence of the protein due to nonsense mediated decay, which is … (more)
Variant summary: SPG7 c.1049_1077del29 (p.Pro350GlnfsX36) results in a premature termination codon, predicted to cause absence of the protein due to nonsense mediated decay, which is a commonly known mechanism for disease. The variant allele was found at a frequency of 1.6e-05 in 250546 control chromosomes (gnomAD). c.1049_1077del29 has been reported in the literature in an individual affected with Hereditary Spastic Paraplegia 7 (Klebe_2012). The following publication has been ascertained in the context of this evaluation (PMID: 23065789). ClinVar contains an entry for this variant (Variation ID: 495055). Based on the evidence outlined above, the variant was classified as pathogenic. (less)
|
|
|
Likely pathogenic
(Jun 01, 2022)
|
no assertion criteria provided
Method: provider interpretation
|
Hereditary spastic paraplegia 7
Affected status: yes
Allele origin:
inherited
|
Solve-RD Consortium
Accession: SCV005200047.1
First in ClinVar: Oct 26, 2024 Last updated: Oct 26, 2024
Comment:
Variant identified during reanalysis of unsolved cases by the Solve-RD project. The Solve-RD project has received funding from the European Union’s Horizon 2020 research and … (more)
Variant identified during reanalysis of unsolved cases by the Solve-RD project. The Solve-RD project has received funding from the European Union’s Horizon 2020 research and innovation programme under grant agreement No 779257. (less)
|
Comment:
Variant confirmed as disease-causing by referring clinical team
|
Comment:
Comment:
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at a significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 23065789, 32816195)
Comment:
This sequence change creates a premature translational stop signal (p.Pro350Glnfs*36) in the SPG7 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SPG7 are known to be pathogenic (PMID: 21623769, 22964162). This variant is present in population databases (rs775364547, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with hereditary spastic paraplegia (PMID: 23065789; Invitae). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 495055). For these reasons, this variant has been classified as Pathogenic.
Comment:
SPG7: PVS1, PM3:Strong, PM2
Comment:
Variant summary: SPG7 c.1049_1077del29 (p.Pro350GlnfsX36) results in a premature termination codon, predicted to cause absence of the protein due to nonsense mediated decay, which is a commonly known mechanism for disease. The variant allele was found at a frequency of 1.6e-05 in 250546 control chromosomes (gnomAD). c.1049_1077del29 has been reported in the literature in an individual affected with Hereditary Spastic Paraplegia 7 (Klebe_2012). The following publication has been ascertained in the context of this evaluation (PMID: 23065789). ClinVar contains an entry for this variant (Variation ID: 495055). Based on the evidence outlined above, the variant was classified as pathogenic.
Comment:
Variant confirmed as disease-causing by referring clinical team
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Comment:
This recessive SPG7 variant was found in compound heterozygosity with one another recessive SPG7 variant in a female patient with spastic paraplegia 7
Comment:
Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed at a significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 23065789, 32816195)
Comment:
This sequence change creates a premature translational stop signal (p.Pro350Glnfs*36) in the SPG7 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in SPG7 are known to be pathogenic (PMID: 21623769, 22964162). This variant is present in population databases (rs775364547, gnomAD 0.004%). This premature translational stop signal has been observed in individual(s) with hereditary spastic paraplegia (PMID: 23065789; Invitae). In at least one individual the data is consistent with being in trans (on the opposite chromosome) from a pathogenic variant. ClinVar contains an entry for this variant (Variation ID: 495055). For these reasons, this variant has been classified as Pathogenic.
Comment:
SPG7: PVS1, PM3:Strong, PM2
Comment:
Variant summary: SPG7 c.1049_1077del29 (p.Pro350GlnfsX36) results in a premature termination codon, predicted to cause absence of the protein due to nonsense mediated decay, which is a commonly known mechanism for disease. The variant allele was found at a frequency of 1.6e-05 in 250546 control chromosomes (gnomAD). c.1049_1077del29 has been reported in the literature in an individual affected with Hereditary Spastic Paraplegia 7 (Klebe_2012). The following publication has been ascertained in the context of this evaluation (PMID: 23065789). ClinVar contains an entry for this variant (Variation ID: 495055). Based on the evidence outlined above, the variant was classified as pathogenic.
Comment:
Variant confirmed as disease-causing by referring clinical team
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Spastic paraplegia gene 7 in patients with spasticity and/or optic neuropathy. | Klebe S | Brain : a journal of neurology | 2012 | PMID: 23065789 |
| Genotype-phenotype correlations in spastic paraplegia type 7: a study in a large Dutch cohort. | van Gassen KL | Brain : a journal of neurology | 2012 | PMID: 22964162 |
| Amplicon-based high-throughput pooled sequencing identifies mutations in CYP7B1 and SPG7 in sporadic spastic paraplegia patients. | Schlipf NA | Clinical genetics | 2011 | PMID: 21623769 |
Text-mined citations for rs775364547 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Nov 03, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.