ClinVar Genomic variation as it relates to human health
NM_000359.3(TGM1):c.398_407dup (p.Tyr136Ter)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_000359.3(TGM1):c.398_407dup (p.Tyr136Ter)
Variation ID: 372530 Accession: VCV000372530.38
- Type and length
-
Duplication, 10 bp
- Location
-
Cytogenetic: 14q12 14: 24261795-24261796 (GRCh38) [ NCBI UCSC ] 14: 24731001-24731002 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jan 9, 2017 Feb 14, 2024 Oct 2, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_000359.3:c.398_407dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_000350.1:p.Tyr136Ter nonsense NM_000359.3:c.398_407dupAGTATGAGTA MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NC_000014.9:g.24261796_24261805dup NC_000014.8:g.24731002_24731011dup NG_007150.1:g.6362_6371dup - Protein change
- Y136*
- Other names
- -
- Canonical SPDI
- NC_000014.9:24261795:TACTCATACT:TACTCATACTTACTCATACT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
TGM1 | - | - |
GRCh38 GRCh38 GRCh37 |
977 | 1010 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Apr 6, 2023 | RCV000414244.8 | |
Pathogenic (5) |
criteria provided, multiple submitters, no conflicts
|
Oct 2, 2023 | RCV000782370.6 | |
Pathogenic (1) |
criteria provided, single submitter
|
Jul 10, 2021 | RCV001836809.1 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Jun 08, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Congenita IIs, Ichthyosis
Affected status: yes
Allele origin:
germline
|
Uitto Lab, Thomas Jefferson University
Study: Rare heritable connective tissue and skin disorders in Iranian cohort
Accession: SCV000920891.1 First in ClinVar: Jun 17, 2019 Last updated: Jun 17, 2019 |
|
|
Pathogenic
(Jul 10, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
Abnormality of the skin
Affected status: yes
Allele origin:
germline
|
Kariminejad - Najmabadi Pathology & Genetics Center
Accession: SCV000927083.2
First in ClinVar: Jul 24, 2019 Last updated: Feb 20, 2022 |
|
|
Pathogenic
(Apr 06, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000490845.2
First in ClinVar: Jan 09, 2017 Last updated: Apr 17, 2019 |
Comment:
Nonsense variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not … (more)
Nonsense variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss-of-function is a known mechanism of disease; Not observed in large population cohorts (Lek et al., 2016); This variant is associated with the following publications: (PMID: 27061915, 28236338, 29444371, 30578701, 31168818) (less)
|
|
Pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
Autosomal recessive congenital ichthyosis 1
Affected status: unknown
Allele origin:
germline
|
Genome-Nilou Lab
Accession: SCV002764017.1
First in ClinVar: Dec 17, 2022 Last updated: Dec 17, 2022 |
|
|
Pathogenic
(May 12, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Autosomal recessive congenital ichthyosis 1
Affected status: unknown
Allele origin:
unknown
|
Fulgent Genetics, Fulgent Genetics
Accession: SCV002779971.1
First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022 |
|
|
Pathogenic
(Apr 06, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV002246711.3
First in ClinVar: Mar 28, 2022 Last updated: Feb 14, 2024 |
Comment:
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this … (more)
For these reasons, this variant has been classified as Pathogenic. Algorithms developed to predict the effect of sequence changes on RNA splicing suggest that this variant may disrupt the consensus splice site. ClinVar contains an entry for this variant (Variation ID: 372530). This premature translational stop signal has been observed in individual(s) with congenital ichthyosis (PMID: 31168818). This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Tyr136*) in the TGM1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in TGM1 are known to be pathogenic (PMID: 18948357, 19241467). (less)
|
|
Pathogenic
(Oct 02, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Autosomal recessive congenital ichthyosis 1
Affected status: unknown
Allele origin:
unknown
|
Baylor Genetics
Accession: SCV004203752.1
First in ClinVar: Dec 30, 2023 Last updated: Dec 30, 2023 |
|
|
Pathogenic
(Mar 12, 2021)
|
no assertion criteria provided
Method: clinical testing
|
Autosomal recessive congenital ichthyosis type 1
Affected status: unknown
Allele origin:
germline
|
Natera, Inc.
Accession: SCV002091237.1
First in ClinVar: Apr 23, 2022 Last updated: Apr 23, 2022 |
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Genotype-phenotype correlation in a large English cohort of patients with autosomal recessive ichthyosis. | Simpson JK | The British journal of dermatology | 2020 | PMID: 31168818 |
Transglutaminase-1 gene mutations in autosomal recessive congenital ichthyosis: summary of mutations (including 23 novel) and modeling of TGase-1. | Herman ML | Human mutation | 2009 | PMID: 19241467 |
Novel transglutaminase-1 mutations and genotype-phenotype investigations of 104 patients with autosomal recessive congenital ichthyosis in the USA. | Farasat S | Journal of medical genetics | 2009 | PMID: 18948357 |
Text-mined citations for rs1057517836 ...
HelpRecord last updated Feb 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.