VCV003256538.1 - ClinVar

NM_001277115.2(DNAH11):c.3545_3551delinsAGATGATGAACTGTAGCTGTAAGA (p.Arg1182fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Likely pathogenic

criteria provided, single submitter

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_001277115.2(DNAH11):c.3545_3551delinsAGATGATGAACTGTAGCTGTAAGA (p.Arg1182fs)

Variation ID: 3256538 Accession: VCV003256538.1

Type and length

Indel, 24 bp

Location

Cytogenetic: 7p15.3 7: 21601515-21601521 (GRCh38) [ NCBI UCSC ] 7: 21641133-21641139 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Aug 4, 2024	Aug 4, 2024	Jul 30, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_001277115.2:c.3545_3551delinsAGATGATGAACTGTAGCTGTAAGA MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_001264044.1:p.Arg1182fs	frameshift
NC_000007.14:g.21601515_21601521delinsAGATGATGAACTGTAGCTGTAAGA
NC_000007.13:g.21641133_21641139delinsAGATGATGAACTGTAGCTGTAAGA
NG_012886.2:g.63301_63307delinsAGATGATGAACTGTAGCTGTAAGA

Protein change

R1182fs

Other names

Canonical SPDI

NC_000007.14:21601514:GACAGAG:AGATGATGAACTGTAGCTGTAAGA

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

VarSome

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
DNAH11		-	-	GRCh38 GRCh37	5393	5773

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Primary ciliary dyskinesia 7	Likely pathogenic (1)	criteria provided, single submitter	Jul 30, 2024	RCV004596009.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Likely pathogenic (Jul 30, 2024)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Primary ciliary dyskinesia 7 (Autosomal recessive inheritance) Affected status: yes Allele origin: germline	Servicio Canario de Salud, Hospital Universitario Nuestra Sra. de Candelaria Accession: SCV005089677.1 First in ClinVar: Aug 04, 2024 Last updated: Aug 04, 2024	Publications: PubMed (1) PubMed: 30389601 Comment: The NM_001277115.2:c.3545_3551delinsAGATGATGAACTGTAGCTGTAAGA, p.(Arg1182Glnfs18) DNAH11 variant has been reported in our laboratory in a 9-year-old male patient with a clinical diagnosis of ciliary dyskinesia primary with … (more) The NM_001277115.2:c.3545_3551delinsAGATGATGAACTGTAGCTGTAAGA, p.(Arg1182Glnfs18) DNAH11 variant has been reported in our laboratory in a 9-year-old male patient with a clinical diagnosis of ciliary dyskinesia primary with situs inversus (liver and heart) and decreased nasal nitric oxide. No other pathogenic variants were found. This variant has never been reported in DNAH11 related-disorders. Loss-of-function variants in DNAH11 are known to be pathogenic. This variant was absent from large population studies (gnomAD no frequency). In summary, the available evidence for NM_001277115.2:c.3545_3551delinsAGATGATGAACTGTAGCTGTAAGA, p.(Arg1182Glnfs*18) DNAH11 variant meets our criteria to be classified as Likely Pathogenic based upon its absence from controls and the clinical correlation in this patient´s phenotype. (less) Indication for testing: Ciliary dyskinesia, primary Age: 0-9 years Sex: female Ethnicity/Population group: caucasian Geographic origin: España

Comment:

The NM_001277115.2:c.3545_3551delinsAGATGATGAACTGTAGCTGTAAGA, p.(Arg1182Glnfs*18) DNAH11 variant has been reported in our laboratory in a 9-year-old male patient with a clinical diagnosis of ciliary dyskinesia primary with situs inversus (liver and heart) and decreased nasal nitric oxide. No other pathogenic variants were found. This variant has never been reported in DNAH11 related-disorders. Loss-of-function variants in DNAH11 are known to be pathogenic. This variant was absent from large population studies (gnomAD no frequency). In summary, the available evidence for NM_001277115.2:c.3545_3551delinsAGATGATGAACTGTAGCTGTAAGA, p.(Arg1182Glnfs*18) DNAH11 variant meets our criteria to be classified as Likely Pathogenic based upon its absence from controls and the clinical correlation in this patient´s phenotype.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Functional characterization and phenotypic spectrum of three recurrent disease-causing deep intronic variants of the CFTR gene.	Bergougnoux A	Journal of cystic fibrosis : official journal of the European Cystic Fibrosis Society	2019	PMID: 30389601

Text-mined citations for this variant ...

Record last updated Aug 11, 2024

ClinVar Genomic variation as it relates to human health

NM_001277115.2(DNAH11):c.3545_3551delinsAGATGATGAACTGTAGCTGTAAGA (p.Arg1182fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for this variant ...