VCV000030292.11 - ClinVar

NM_006015.6(ARID1A):c.31_56del (p.Ser11fs)

Germline

Classification

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(5)

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Pathogenic

criteria provided, multiple submitters, no conflicts

Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Identifiers

NM_006015.6(ARID1A):c.31_56del (p.Ser11fs)

Variation ID: 30292 Accession: VCV000030292.11

Type and length

Deletion, 26 bp

Location

Cytogenetic: 1p36.11 1: 26696422-26696447 (GRCh38) [ NCBI UCSC ] 1: 27022913-27022938 (GRCh37) [ NCBI UCSC ]

Timeline in ClinVar

	First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.	Last submission Help The date of the most recent submission for each type of classification for this variant.	Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline	Oct 5, 2015	Sep 8, 2024	Apr 19, 2024

HGVS

Nucleotide	Protein	Molecular consequence
NM_006015.6:c.31_56del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.	NP_006006.3:p.Ser11fs	frameshift
NM_006015.4:c.31_56delAGCAGCCTGGGCAACCCGCCGCCGCC
NM_139135.4:c.31_56del	NP_624361.1:p.Ser11fs	frameshift
NC_000001.11:g.26696434_26696459del
NC_000001.10:g.27022925_27022950del
NG_029965.1:g.5404_5429del
LRG_875:g.5404_5429del
LRG_875t1:c.31_56del
LRG_875t1:c.31_56del26

... more HGVS ... less HGVS

Protein change

S11fs

Other names

Canonical SPDI

NC_000001.11:26696421:CCCGCCGCCGCCAGCAGCCTGGGCAACCCGCCGCCGCC:CCCGCCGCCGCC

Functional consequence Help The effect of the variant on RNA or protein function, based on experimental evidence from submitters.

Global minor allele frequency (GMAF) Help The global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.

Allele frequency Help The frequency of the allele represented by this VCV record.

Links

ClinGen: CA209547 OMIM: 603024.0001 dbSNP: rs797045262 VarSome

Comment on variant

NCBI staff reviewed the sequence information reported in PubMed 22426308 Supplementary Fig. 4 to determine the location of this allele on the current reference sequence.

Genes

Gene	OMIM	ClinGen Gene Dosage Sensitivity Curation		Variation Viewer Help Links to Variation Viewer, a genome browser to view variation data from NCBI databases.	Related variants
Gene	OMIM	HI score Help The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.	TS score Help The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team.		Within gene Help The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants.	All Help The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene.
ARID1A		Sufficient evidence for dosage pathogenicity	No evidence available	GRCh38 GRCh37	1165	1358

Conditions - Germline

Condition Help The condition for this variant-condition (RCV) record in ClinVar.	Classification Help The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions)	Review status Help The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status.	Last evaluated Help The most recent date that a submitter evaluated this variant for the condition.	Variation/condition record Help The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page.
Intellectual disability, autosomal dominant 14	Pathogenic (3)	criteria provided, multiple submitters, no conflicts	Apr 19, 2024	RCV000023227.10
not provided	Pathogenic (1)	criteria provided, single submitter	Mar 22, 2022	RCV000480869.5
Coffin-Siris syndrome 1	Pathogenic (1)	criteria provided, single submitter	May 15, 2023	RCV003314556.1

Submissions - Germline

Classification Help The submitted germline classification for each SCV record. (Last evaluated)	Review status Help Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria)	Condition Help The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant.	Submitter Help The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar.	More information Help This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter.
Pathogenic (Mar 22, 2022)	criteria provided, single submitter (GeneDx Variant Classification Process June 2021) Method: clinical testing	Not Provided Affected status: yes Allele origin: germline	GeneDx Accession: SCV000566684.6 First in ClinVar: Apr 27, 2017 Last updated: Mar 04, 2023	Comment: Identified in a patient with Coffin-Siris syndrome in the published literature (Tsurusaki et al., 2012; Kosho et al., 2014); Frameshift variant predicted to result in … (more) Identified in a patient with Coffin-Siris syndrome in the published literature (Tsurusaki et al., 2012; Kosho et al., 2014); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 25168959, 24090879, 27082517, 22426308) (less)
Pathogenic (May 15, 2023)	criteria provided, single submitter (ICSLVariantClassificationCriteria RUGD 01 April 2020) Method: clinical testing	Coffin-Siris syndrome 1 Affected status: unknown Allele origin: unknown	Illumina Laboratory Services, Illumina Accession: SCV004014664.1 First in ClinVar: Jul 22, 2023 Last updated: Jul 22, 2023	Publications: PubMed (2) PubMed: 22426308‚ 25168959 Comment: The ARID1A c.31_56del (p.Ser11AlafsTer91) variant causes a shift in the protein reading frame that is predicted to result in premature termination of the protein. Loss … (more) The ARID1A c.31_56del (p.Ser11AlafsTer91) variant causes a shift in the protein reading frame that is predicted to result in premature termination of the protein. Loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay is expected. This variant has been reported in one individual with Coffin-Siris syndrome, in whom parental samples were unavailable to confirm the de novo status of the variant (PMID: 22426308; 25168959). The p.Ser11AlafsTer91 variant is not observed in version 2.1.1 or version 3.1.2 of the Genome Aggregation Database. This variant was identified in a de novo state. Based on the available evidence, the c.31_56del (p.Ser11AlafsTer91) variant is classified as pathogenic for Coffin-Siris syndrome. (less)
Pathogenic (Apr 19, 2024)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Intellectual disability, autosomal dominant 14 Affected status: yes Allele origin: germline	Greenwood Genetic Center Diagnostic Laboratories, Greenwood Genetic Center Accession: SCV005200938.1 First in ClinVar: Sep 08, 2024 Last updated: Sep 08, 2024	Comment: PVS1, PS4_Moderate, PM2
Pathogenic (Jun 02, 2015)	criteria provided, single submitter (ACMG Guidelines, 2015) Method: clinical testing	Mental retardation, autosomal dominant 14 Affected status: yes Allele origin: germline	Genetic Services Laboratory, University of Chicago Accession: SCV000246490.1 First in ClinVar: Oct 05, 2015 Last updated: Oct 05, 2015
Pathogenic (Mar 18, 2012)	no assertion criteria provided Method: literature only	COFFIN-SIRIS SYNDROME 2 Affected status: not provided Allele origin: germline	OMIM Accession: SCV000044518.2 First in ClinVar: Apr 04, 2013 Last updated: May 01, 2016	Publications: PubMed (1) PubMed: 22426308 Comment on evidence: In Patient 3 with Coffin-Siris syndrome (CSS2; 614607), Tsurusaki et al. (2012) detected a heterozygous 26-bp deletion (31_56del) in the ARID1A gene, resulting in frameshift … (more) In Patient 3 with Coffin-Siris syndrome (CSS2; 614607), Tsurusaki et al. (2012) detected a heterozygous 26-bp deletion (31_56del) in the ARID1A gene, resulting in frameshift and premature termination 91 amino acids downstream (Ser11AlafsTer91). The patient presented with hepatoblastoma as well as multiple congenital anomalies. This mutation was not identified in 330 control chromosomes or in the dbSNP (build 132), 1000 Genomes Project, or Exome Sequencing Project databases. The parents were unavailable for testing. (less)

Comment:

Identified in a patient with Coffin-Siris syndrome in the published literature (Tsurusaki et al., 2012; Kosho et al., 2014); Frameshift variant predicted to result in protein truncation or nonsense mediated decay in a gene for which loss of function is a known mechanism of disease; Not observed at significant frequency in large population cohorts (gnomAD); This variant is associated with the following publications: (PMID: 25168959, 24090879, 27082517, 22426308)

Comment:

The ARID1A c.31_56del (p.Ser11AlafsTer91) variant causes a shift in the protein reading frame that is predicted to result in premature termination of the protein. Loss of normal protein function through either protein truncation or nonsense-mediated mRNA decay is expected. This variant has been reported in one individual with Coffin-Siris syndrome, in whom parental samples were unavailable to confirm the de novo status of the variant (PMID: 22426308; 25168959). The p.Ser11AlafsTer91 variant is not observed in version 2.1.1 or version 3.1.2 of the Genome Aggregation Database. This variant was identified in a de novo state. Based on the available evidence, the c.31_56del (p.Ser11AlafsTer91) variant is classified as pathogenic for Coffin-Siris syndrome.

Germline Functional Evidence

There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar.

Comment:

Citations for germline classification of this variant

Title	Author	Journal	Year	Link
Genotype-phenotype correlation of Coffin-Siris syndrome caused by mutations in SMARCB1, SMARCA4, SMARCE1, and ARID1A.	Kosho T	American journal of medical genetics. Part C, Seminars in medical genetics	2014	PMID: 25168959
Mutations affecting components of the SWI/SNF complex cause Coffin-Siris syndrome.	Tsurusaki Y	Nature genetics	2012	PMID: 22426308

Text-mined citations for rs797045262 ...

These citations are identified by LitVar using the rs number, so they may include citations for more than one variant at this location. Please review the LitVar results carefully for your variant of interest.

Record last updated Sep 08, 2024

ClinVar Genomic variation as it relates to human health

NM_006015.6(ARID1A):c.31_56del (p.Ser11fs)

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Text-mined citations for rs797045262 ...