ClinVar Genomic variation as it relates to human health
NM_201525.4(ADGRG1):c.532_553del (p.Glu178fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_201525.4(ADGRG1):c.532_553del (p.Glu178fs)
Variation ID: 2962815 Accession: VCV002962815.1
- Type and length
-
Deletion, 22 bp
- Location
-
Cytogenetic: 16q21 16: 57653245-57653266 (GRCh38) [ NCBI UCSC ] 16: 57687157-57687178 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 29, 2024 Feb 28, 2024 Apr 13, 2023 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_201525.4:c.532_553del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_958933.1:p.Glu178fs frameshift NM_001145770.3:c.532_553del NP_001139242.1:p.Glu178fs frameshift NM_001145771.3:c.532_553del NP_001139243.1:p.Glu178fs frameshift NM_001145772.3:c.532_553del NP_001139244.1:p.Glu178fs frameshift NM_001145773.3:c.547_568del NP_001139245.1:p.Glu183fs frameshift NM_001145774.3:c.532_553del NP_001139246.1:p.Glu178fs frameshift NM_001290142.2:c.111-739_111-718del intron variant NM_001290143.2:c.7_28del NP_001277072.1:p.Glu3fs frameshift NM_001290144.2:c.7_28del NP_001277073.1:p.Glu3fs frameshift NM_001370428.1:c.532_553del NP_001357357.1:p.Glu178fs frameshift NM_001370429.1:c.532_553del NP_001357358.1:p.Glu178fs frameshift NM_001370430.1:c.532_553del NP_001357359.1:p.Glu178fs frameshift NM_001370431.1:c.532_553del NP_001357360.1:p.Glu178fs frameshift NM_001370432.1:c.532_553del NP_001357361.1:p.Glu178fs frameshift NM_001370433.1:c.547_568del NP_001357362.1:p.Glu183fs frameshift NM_001370434.1:c.532_553del NP_001357363.1:p.Glu178fs frameshift NM_001370435.1:c.532_553del NP_001357364.1:p.Glu178fs frameshift NM_001370436.1:c.532_553del NP_001357365.1:p.Glu178fs frameshift NM_001370437.1:c.532_553del NP_001357366.1:p.Glu178fs frameshift NM_001370438.1:c.532_553del NP_001357367.1:p.Glu178fs frameshift NM_001370439.1:c.532_553del NP_001357368.1:p.Glu178fs frameshift NM_001370440.1:c.532_553del NP_001357369.1:p.Glu178fs frameshift NM_001370441.1:c.532_553del NP_001357370.1:p.Glu178fs frameshift NM_001370442.1:c.376_397del NP_001357371.1:p.Glu126fs frameshift NM_001370451.1:c.7_28del NP_001357380.1:p.Glu3fs frameshift NM_001370453.1:c.7_28del NP_001357382.1:p.Glu3fs frameshift NM_001370454.1:c.7_28del NP_001357383.1:p.Glu3fs frameshift NM_005682.7:c.532_553del NP_005673.3:p.Glu178fs frameshift NM_201524.4:c.532_553del NP_958932.1:p.Glu178fs frameshift NC_000016.10:g.57653247_57653268del NC_000016.9:g.57687159_57687180del NG_011643.1:g.38250_38271del - Protein change
- E126fs, E3fs, E178fs, E183fs
- Other names
- -
- Canonical SPDI
- NC_000016.10:57653244:GCGAGCTCAAAAGGGACCTCCAGC:GC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
ADGRG1 | - | - |
GRCh38 GRCh37 |
943 | 971 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Apr 13, 2023 | RCV003827925.2 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Apr 13, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV004621488.1
First in ClinVar: Feb 28, 2024 Last updated: Feb 28, 2024 |
Comment:
For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with ADGRG1-related conditions. … (more)
For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with ADGRG1-related conditions. This variant is present in population databases (no rsID available, gnomAD 0.003%). This sequence change creates a premature translational stop signal (p.Glu178Cysfs*6) in the ADGRG1 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in ADGRG1 are known to be pathogenic (PMID: 15044805, 20929962). (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
GPR56-related bilateral frontoparietal polymicrogyria: further evidence for an overlap with the cobblestone complex. | Bahi-Buisson N | Brain : a journal of neurology | 2010 | PMID: 20929962 |
G protein-coupled receptor-dependent development of human frontal cortex. | Piao X | Science (New York, N.Y.) | 2004 | PMID: 15044805 |
Text-mined citations for this variant ...
HelpRecord last updated Sep 30, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.