ClinVar Genomic variation as it relates to human health
NM_174936.4(PCSK9):c.45GCT[9] (p.Leu22_Leu23dup)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
Uncertain significance(1); Benign(5); Likely benign(6)
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_174936.4(PCSK9):c.45GCT[9] (p.Leu22_Leu23dup)
Variation ID: 265916 Accession: VCV000265916.64
- Type and length
-
Microsatellite, 6 bp
- Location
-
Cytogenetic: 1p32.3 1: 55505552-55505553 (GRCh37) [ NCBI UCSC ] 1: 55039879-55039880 (GRCh38) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Oct 15, 2016 May 12, 2024 Jan 31, 2024 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_174936.4:c.45GCT[9] MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_777596.2:p.Leu22_Leu23dup inframe insertion NM_174936.3:c.60_65dupGCTGCT NC_000001.11:g.55039882GCT[9] NC_000001.10:g.55505555GCT[9] NG_009061.1:g.5336GCT[9] NG_009061.1:g.5351_5356dup LRG_275:g.5336GCT[9] - Protein change
- Other names
- -
- Canonical SPDI
- NC_000001.11:55039879:CTGCTGCTGCTGCTGCTGCTGCT:CTGCTGCTGCTGCTGCTGCTGCTGCTGCT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
-
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
-
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
-
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
PCSK9 | Dosage sensitivity unlikely | No evidence available |
GRCh38 GRCh37 |
1264 | 1277 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Conflicting interpretations of pathogenicity (4) |
criteria provided, conflicting classifications
|
Jan 2, 2018 | RCV000256321.15 | |
Benign/Likely benign (4) |
criteria provided, multiple submitters, no conflicts
|
Dec 1, 2023 | RCV000590072.23 | |
Benign/Likely benign (2) |
criteria provided, multiple submitters, no conflicts
|
Nov 5, 2021 | RCV000484438.14 | |
Likely benign (1) |
criteria provided, single submitter
|
Jun 29, 2018 | RCV000776036.10 | |
Benign (1) |
criteria provided, single submitter
|
Jan 31, 2024 | RCV001081155.17 | |
Likely benign (1) |
criteria provided, single submitter
|
Jul 30, 2018 | RCV002356357.9 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Uncertain significance
(Mar 01, 2016)
|
criteria provided, single submitter
Method: research
|
Familial hypercholesterolemia
Affected status: yes
Allele origin:
germline
|
Cardiovascular Research Group, Instituto Nacional de Saude Doutor Ricardo Jorge
Accession: SCV000323027.1
First in ClinVar: Oct 15, 2016 Last updated: Oct 15, 2016 |
Comment:
0/100 French Canadian and 0/100 French normolipidemic and trigliceridemic controls; 0/100 Tunisian normolipidemic individuals
Observation 1:
Comment on evidence:
%MAF (ExAC):0.2212
Observation 2: |
|
Benign
(Oct 12, 2016)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Women's Health and Genetics/Laboratory Corporation of America, LabCorp
Accession: SCV000699999.1
First in ClinVar: Mar 17, 2018 Last updated: Mar 17, 2018 |
Comment:
Variant summary: The PCSK9 c.60_65dupGCTGCT (p.Leu20_Leu21dup) variant involves the duplication of 6 nucleotides in a Leucine repeat region, changing 9 Leucines to 11 Leucines. Mutation … (more)
Variant summary: The PCSK9 c.60_65dupGCTGCT (p.Leu20_Leu21dup) variant involves the duplication of 6 nucleotides in a Leucine repeat region, changing 9 Leucines to 11 Leucines. Mutation taster predicts a benign outcome for this variant. This variant was found in 49/22348 control chromosomes (1 homozygote) at a frequency of 0.0021926, which is approximately 23 times the estimated maximal expected allele frequency of a pathogenic PCSK9 variant (0.0000938), suggesting this variant is likely a benign polymorphism. This variant has been reported in families with FH and FCHL but did not clearly cosegregate with disease. Additionally, the variant has been reported in patients that carry other pathogenic variants which would suggest that this is a benign variant. Taken together, this variant is classified as benign. (less)
|
|
Likely benign
(Feb 05, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV000572390.4
First in ClinVar: Apr 29, 2017 Last updated: Apr 09, 2018 |
Comment:
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at … (more)
This variant is considered likely benign or benign based on one or more of the following criteria: it is a conservative change, it occurs at a poorly conserved position in the protein, it is predicted to be benign by multiple in silico algorithms, and/or has population frequency not consistent with disease. (less)
|
|
Likely benign
(Jan 02, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Hypercholesterolemia, familial, 1
(Autosomal dominant inheritance)
Affected status: yes
Allele origin:
germline
|
Robarts Research Institute, Western University
Accession: SCV000782987.1
First in ClinVar: Feb 19, 2018 Last updated: Feb 19, 2018 |
|
|
Likely benign
(Jun 29, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Familial hypercholesterolemias
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV000910635.1
First in ClinVar: May 20, 2019 Last updated: May 20, 2019 |
|
|
Likely benign
(Jul 07, 2017)
|
criteria provided, single submitter
Method: clinical testing
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Color Diagnostics, LLC DBA Color Health
Accession: SCV000690982.2
First in ClinVar: Feb 19, 2018 Last updated: Dec 11, 2022 |
|
|
Benign
(Jul 28, 2020)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
unknown
|
Quest Diagnostics Nichols Institute San Juan Capistrano
Accession: SCV001470594.3
First in ClinVar: Jan 26, 2021 Last updated: Jan 06, 2024 |
|
|
Benign
(Jan 31, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Hypercholesterolemia, autosomal dominant, 3
Affected status: unknown
Allele origin:
germline
|
Invitae
Accession: SCV000555874.10
First in ClinVar: Apr 17, 2017 Last updated: Feb 20, 2024 |
|
|
Likely benign
(Oct 23, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
ARUP Laboratories, Molecular Genetics and Genomics, ARUP Laboratories
Accession: SCV003799483.3
First in ClinVar: Feb 13, 2023 Last updated: Feb 20, 2024 |
|
|
Benign
(Nov 05, 2021)
|
criteria provided, single submitter
Method: clinical testing
|
not specified
Affected status: unknown
Allele origin:
germline
|
Laboratory for Molecular Medicine, Mass General Brigham Personalized Medicine
Accession: SCV004848596.1
First in ClinVar: Apr 20, 2024 Last updated: Apr 20, 2024 |
Comment:
The p.Leu22_Leu23dup variant in PCSK9 is classified as benign because it has been identified in 0.74% (65/8730) of Ashkenazi Jewish chromosomes by gnomAD (http://gnomad.broadinstitute.org). ACMG/AMP … (more)
The p.Leu22_Leu23dup variant in PCSK9 is classified as benign because it has been identified in 0.74% (65/8730) of Ashkenazi Jewish chromosomes by gnomAD (http://gnomad.broadinstitute.org). ACMG/AMP Criteria applied: BA1. (less)
|
|
Likely benign
(Jul 30, 2018)
|
criteria provided, single submitter
Method: clinical testing
|
Cardiovascular phenotype
Affected status: unknown
Allele origin:
germline
|
Ambry Genetics
Accession: SCV002656171.2
First in ClinVar: Nov 29, 2022 Last updated: May 01, 2024 |
Comment:
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of … (more)
This alteration is classified as likely benign based on a combination of the following: seen in unaffected individuals, population frequency, intact protein function, lack of segregation with disease, co-occurrence, RNA analysis, in silico models, amino acid conservation, lack of disease association in case-control studies, and/or the mechanism of disease or impacted region is inconsistent with a known cause of pathogenicity. (less)
|
|
Benign
(Dec 01, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: yes
Allele origin:
germline
|
CeGaT Center for Human Genetics Tuebingen
Accession: SCV002821399.9
First in ClinVar: Jan 21, 2023 Last updated: May 12, 2024 |
Comment:
PCSK9: BS1, BS2
Number of individuals with the variant: 19
|
|
Benign
(-)
|
no assertion criteria provided
Method: research
|
Familial hypercholesterolemia
Affected status: unknown
Allele origin:
germline
|
Laboratorium voor Moleculaire Diagnostiek Experimentele Vasculaire Geneeskunde, Academisch Medisch Centrum
Accession: SCV000606671.1
First in ClinVar: Oct 15, 2016 Last updated: Oct 15, 2016 |
|
|
click to load more click to collapse |
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Autosomal dominant hypercholesterolemia in Catalonia: Correspondence between clinical-biochemical and genetic diagnostics in 967 patients studied in a multicenter clinical setting. | Martín-Campos JM | Journal of clinical lipidology | 2018 | PMID: 30293936 |
Spectrum of mutations in Italian patients with familial hypercholesterolemia: New results from the LIPIGEN study. | Pirillo A | Atherosclerosis. Supplements | 2017 | PMID: 28965616 |
Homozygous Familial Hypercholesterolemia in Spain: Prevalence and Phenotype-Genotype Relationship. | Sánchez-Hernández RM | Circulation. Cardiovascular genetics | 2016 | PMID: 27784735 |
PCSK9 polymorphism in a Tunisian cohort: identification of a new allele, L8, and association of allele L10 with reduced coronary heart disease risk. | Slimani A | Molecular and cellular probes | 2015 | PMID: 25239117 |
Regional distribution and metabolic effect of PCSK9 insLEU and R46L gene mutations and apoE genotype. | Awan Z | The Canadian journal of cardiology | 2013 | PMID: 23743349 |
Effect of mutations in LDLR and PCSK9 genes on phenotypic variability in Tunisian familial hypercholesterolemia patients. | Slimani A | Atherosclerosis | 2012 | PMID: 22417841 |
Leucine 10 allelic variant in signal peptide of PCSK9 increases the LDL cholesterol-lowering effect of statins in patients with familial hypercholesterolaemia. | Pisciotta L | Nutrition, metabolism, and cardiovascular diseases : NMCD | 2012 | PMID: 21920719 |
Plasma PCSK9 is associated with age, sex, and multiple metabolic markers in a population-based sample of children and adolescents. | Baass A | Clinical chemistry | 2009 | PMID: 19628659 |
New technologies for delineating and characterizing the lipid exome: prospects for understanding familial combined hyperlipidemia. | Horswell SD | Journal of lipid research | 2009 | PMID: 19023136 |
A PCSK9 variant and familial combined hyperlipidaemia. | Abifadel M | Journal of medical genetics | 2008 | PMID: 18708425 |
The c.43_44insCTG variation in PCSK9 is associated with low plasma LDL-cholesterol in a Caucasian population. | Yue P | Human mutation | 2006 | PMID: 16619215 |
A common PCSK9 haplotype, encompassing the E670G coding single nucleotide polymorphism, is a novel genetic marker for plasma low-density lipoprotein cholesterol levels and severity of coronary atherosclerosis. | Chen SN | Journal of the American College of Cardiology | 2005 | PMID: 15893176 |
NARC-1/PCSK9 and its natural mutants: zymogen cleavage and effects on the low density lipoprotein (LDL) receptor and LDL cholesterol. | Benjannet S | The Journal of biological chemistry | 2004 | PMID: 15358785 |
click to load more click to collapse |
Text-mined citations for rs35574083 ...
HelpRecord last updated May 12, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.