Skip to main page content
U.S. flag

An official website of the United States government

Dot gov

The .gov means it’s official.
Federal government websites often end in .gov or .mil. Before sharing sensitive information, make sure you’re on a federal government site.

Https

The site is secure.
The https:// ensures that you are connecting to the official website and that any information you provide is encrypted and transmitted securely.

Access keys NCBI Homepage MyNCBI Homepage Main Content Main Navigation

ClinVar Genomic variation as it relates to human health

Advanced search

NM_001101426.4(CRPPA):c.*2369_*2379TA[3]CGTACACATACACACATATATGTATATACGTAC[1]

Germline
Classification Help

The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.

(1) Help

Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.

Likely benign
criteria provided, single submitter
Somatic

No data submitted for somatic clinical impact

Somatic

No data submitted for oncogenicity

Variant Details

Genes

Conditions - Germline

Submissions - Germline

Germline Functional Evidence

Citations for germline classification of this variant

Help

Text-mined citations for this variant ...

Help

Record last updated Oct 20, 2024