ClinVar Genomic variation as it relates to human health
NM_001351132.2(PEX5):c.54_69dup (p.Phe24fs)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_001351132.2(PEX5):c.54_69dup (p.Phe24fs)
Variation ID: 2082711 Accession: VCV002082711.2
- Type and length
-
Duplication, 16 bp
- Location
-
Cytogenetic: 12p13.31 12: 7190430-7190431 (GRCh38) [ NCBI UCSC ] 12: 7343026-7343027 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Feb 8, 2023 Feb 20, 2024 Jan 14, 2022 - HGVS
-
Nucleotide Protein Molecular
consequenceNM_001351132.2:c.54_69dup MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_001338061.1:p.Phe24fs frameshift NM_000319.5:c.54_69dup NP_000310.2:p.Phe24fs frameshift NM_001131023.2:c.54_69dup NP_001124495.1:p.Phe24fs frameshift NM_001131024.2:c.54_69dup NP_001124496.1:p.Phe24fs frameshift NM_001131025.2:c.54_69dup NP_001124497.1:p.Phe24fs frameshift NM_001131026.2:c.54_69dup NP_001124498.1:p.Phe24fs frameshift NM_001300789.3:c.54_69dup NP_001287718.2:p.Phe24fs frameshift NM_001351124.3:c.54_69dup NP_001338053.1:p.Phe24fs frameshift NM_001351126.2:c.54_69dup NP_001338055.1:p.Phe24fs frameshift NM_001351127.2:c.54_69dup NP_001338056.1:p.Phe24fs frameshift NM_001351128.2:c.54_69dup NP_001338057.1:p.Phe24fs frameshift NM_001351130.3:c.54_69dup NP_001338059.1:p.Phe24fs frameshift NM_001351131.2:c.54_69dup NP_001338060.1:p.Phe24fs frameshift NM_001351133.2:c.54_69dup NP_001338062.1:p.Phe24fs frameshift NM_001351134.2:c.54_69dup NP_001338063.1:p.Phe24fs frameshift NM_001351135.3:c.54_69dup NP_001338064.2:p.Phe24fs frameshift NM_001351136.2:c.54_69dup NP_001338065.1:p.Phe24fs frameshift NM_001351137.3:c.54_69dup NP_001338066.2:p.Phe24fs frameshift NM_001351138.2:c.54_69dup NP_001338067.1:p.Phe24fs frameshift NM_001351139.2:c.54_69dup NP_001338068.1:p.Phe24fs frameshift NM_001351140.2:c.54_69dup NP_001338069.1:p.Phe24fs frameshift NM_001374645.1:c.54_69dup NP_001361574.1:p.Phe24fs frameshift NM_001374646.1:c.54_69dup NP_001361575.1:p.Phe24fs frameshift NM_001374647.2:c.54_69dup NP_001361576.1:p.Phe24fs frameshift NM_001374648.2:c.54_69dup NP_001361577.1:p.Phe24fs frameshift NM_001374649.2:c.54_69dup NP_001361578.1:p.Phe24fs frameshift NC_000012.12:g.7190431_7190446dup NC_000012.11:g.7343027_7343042dup NG_008448.1:g.6269_6284dup NG_125086.1:g.272_287dup - Protein change
- F24fs
- Other names
- -
- Canonical SPDI
- NC_000012.12:7190430:GAAGCTCGCCGGGCAC:GAAGCTCGCCGGGCACGAAGCTCGCCGGGCAC
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
---|---|---|---|---|---|---|
HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
PEX5 | - | - |
GRCh38 GRCh38 GRCh37 |
990 | 1042 |
Conditions - Germline
Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
---|---|---|---|---|
Pathogenic (1) |
criteria provided, single submitter
|
Jan 14, 2022 | RCV003008926.3 |
Submissions - Germline
Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
---|---|---|---|---|---|
Pathogenic
(Jan 14, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Peroxisome biogenesis disorder 2B
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV003295965.2
First in ClinVar: Feb 07, 2023 Last updated: Feb 20, 2024 |
Comment:
For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with PEX5-related conditions. … (more)
For these reasons, this variant has been classified as Pathogenic. This variant has not been reported in the literature in individuals affected with PEX5-related conditions. This variant is not present in population databases (gnomAD no frequency). This sequence change creates a premature translational stop signal (p.Phe24Glufs*30) in the PEX5 gene. It is expected to result in an absent or disrupted protein product. Loss-of-function variants in PEX5 are known to be pathogenic (PMID: 18712838, 21031596). (less)
|
Germline Functional Evidence
There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
HelpTitle | Author | Journal | Year | Link |
---|---|---|---|---|
Genetic classification and mutational spectrum of more than 600 patients with a Zellweger syndrome spectrum disorder. | Ebberink MS | Human mutation | 2011 | PMID: 21031596 |
Genotype-phenotype correlation in PEX5-deficient peroxisome biogenesis defective cell lines. | Ebberink MS | Human mutation | 2009 | PMID: 18712838 |
Text-mined citations for this variant ...
HelpRecord last updated Sep 29, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.