ClinVar Genomic variation as it relates to human health
NM_173842.3(IL1RN):c.206-516ATCCTGGGGAAAGTGAGGGAAATATGGACATCACATGGAACAACATCCAGGAGACTCAGGCCTCTAGGAGTAACTGGGTAGTGTGC[2]
Germline
Classification
(2)
Pathogenic; risk factor
no assertion criteria provided
Somatic
No data submitted for somatic clinical impact
Somatic
No data submitted for oncogenicity
Genes
Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation | Variation Viewer | Related variants | ||
---|---|---|---|---|---|---|
HI score | TS score | Within gene | All | |||
IL1RN | - | - |
GRCh38 GRCh37 |
223 | 246 |
Conditions - Germline
Condition | Classification
(# of submissions) |
Review status | Last evaluated | Variation/condition record |
---|---|---|---|---|
Gastric cancer susceptibility after h. pylori infection
|
Pathogenic (1) |
|
Jul 1, 2006 | RCV000015787.27 |
risk factor (1) |
|
Jul 1, 2006 | RCV000015788.4 |
Citations for germline classification of this variant
HelpText-mined citations for rs2234663 ...
HelpThese citations are identified by LitVar using
the rs number, so they may include citations for more than one variant
at this location. Please review the LitVar results carefully for your
variant of interest.
Record last updated Dec 25, 2023
NCBI staff provided an HGVS expression for the IL1RN*2 allele based on the primers described to amplify the intronic sequence and the record of the VNTR in dbSNP (rs2234663).