ClinVar Genomic variation as it relates to human health
NM_006005.3(WFS1):c.1525_1539del (p.Val509_Tyr513del)
The aggregate germline classification for this variant, typically for a monogenic or Mendelian disorder as in the ACMG/AMP guidelines, or for response to a drug. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the aggregate classification.
Stars represent the aggregate review status, or the level of review supporting the aggregate germline classification for this VCV record. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. The number of submissions which contribute to this review status is shown in parentheses.
No data submitted for somatic clinical impact
No data submitted for oncogenicity
Variant Details
- Identifiers
-
NM_006005.3(WFS1):c.1525_1539del (p.Val509_Tyr513del)
Variation ID: 1453842 Accession: VCV001453842.14
- Type and length
-
Deletion, 15 bp
- Location
-
Cytogenetic: 4p16.1 4: 6301310-6301324 (GRCh38) [ NCBI UCSC ] 4: 6303037-6303051 (GRCh37) [ NCBI UCSC ]
- Timeline in ClinVar
-
First in ClinVar Help The date this variant first appeared in ClinVar with each type of classification.
Last submission Help The date of the most recent submission for each type of classification for this variant.
Last evaluated Help The most recent date that a submitter evaluated this variant for each type of classification.
Germline Jul 30, 2015 Oct 13, 2024 Sep 22, 2024 - HGVS
-
... more HGVS ... less HGVSNucleotide Protein Molecular
consequenceNM_006005.3:c.1525_1539del MANE Select Help Transcripts from the Matched Annotation from the NCBI and EMBL-EBI (MANE) collaboration.
NP_005996.2:p.Val509_Tyr513del inframe deletion NM_001145853.1:c.1525_1539del NP_001139325.1:p.Val509_Tyr513del inframe deletion NC_000004.12:g.6301320_6301334del NC_000004.11:g.6303047_6303061del NG_011700.1:g.36471_36485del LRG_1417:g.36471_36485del LRG_1417t1:c.1525_1539del LRG_1417p1:p.Val509_Tyr513del - Protein change
- -
- Other names
-
NG_011700.1:g.36471_36485del
NP_005996.2:p.(Val509_Tyr513del)
- Canonical SPDI
- NC_000004.12:6301309:CCTGCTCTATGTCTACCTGCTCTAT:CCTGCTCTAT
-
Functional
consequence HelpThe effect of the variant on RNA or protein function, based on experimental evidence from submitters.
- -
-
Global minor allele
frequency (GMAF) HelpThe global minor allele frequency calculated by the 1000 Genomes Project. The minor allele at this location is indicated in parentheses and may be different from the allele represented by this VCV record.
- -
-
Allele frequency
Help
The frequency of the allele represented by this VCV record.
- -
- Links
Genes
| Gene | OMIM | ClinGen Gene Dosage Sensitivity Curation |
Variation Viewer
Help
Links to Variation Viewer, a genome browser to view variation data from NCBI databases. |
Related variants | ||
|---|---|---|---|---|---|---|
| HI score
Help
The haploinsufficiency score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
TS score
Help
The triplosensitivity score for the gene, curated by ClinGen’s Dosage Sensitivity Curation task team. |
Within gene
Help
The number of variants in ClinVar that are contained within this gene, with a link to view the list of variants. |
All
Help
The number of variants in ClinVar for this gene, including smaller variants within the gene and larger CNVs that overlap or fully contain the gene. |
|||
| WFS1 | No evidence available | No evidence available |
GRCh38 GRCh37 |
1756 | 1857 | |
Conditions - Germline
| Condition
Help
The condition for this variant-condition (RCV) record in ClinVar. |
Classification
Help
The aggregate germline classification for this variant-condition (RCV) record in ClinVar. The number of submissions that contribute to this aggregate classification is shown in parentheses. (# of submissions) |
Review status
Help
The aggregate review status for this variant-condition (RCV) record in ClinVar. This value is calculated by NCBI based on data from submitters. Read our rules for calculating the review status. |
Last evaluated
Help
The most recent date that a submitter evaluated this variant for the condition. |
Variation/condition record
Help
The RCV accession number, with most recent version number, for the variant-condition record, with a link to the RCV web page. |
|---|---|---|---|---|
| Pathogenic/Likely pathogenic (2) |
criteria provided, multiple submitters, no conflicts
|
Sep 11, 2024 | RCV001941578.11 | |
| Pathogenic (3) |
criteria provided, multiple submitters, no conflicts
|
Sep 22, 2024 | RCV002274237.8 | |
| Pathogenic (1) |
criteria provided, single submitter
|
Apr 26, 2022 | RCV002507696.4 | |
| Likely pathogenic (1) |
criteria provided, single submitter
|
- | RCV003336476.1 |
Submissions - Germline
| Classification
Help
The submitted germline classification for each SCV record. (Last evaluated) |
Review status
Help
Stars represent the review status, or the level of review supporting the submitted (SCV) record. This value is calculated by NCBI based on data from the submitter. Read our rules for calculating the review status. This column also includes a link to the submitter’s assertion criteria if provided, and the collection method. (Assertion criteria) |
Condition
Help
The condition for the classification, provided by the submitter for this submitted (SCV) record. This column also includes the affected status and allele origin of individuals observed with this variant. |
Submitter
Help
The submitting organization for this submitted (SCV) record. This column also includes the SCV accession and version number, the date this SCV first appeared in ClinVar, and the date that this SCV was last updated in ClinVar. |
More information
Help
This column includes more information supporting the classification, including citations, the comment on classification, and detailed evidence provided as observations of the variant by the submitter. |
|
|---|---|---|---|---|---|
|
Pathogenic
(Apr 26, 2022)
|
criteria provided, single submitter
Method: clinical testing
|
Cataract 41
Type 2 diabetes mellitus Wolfram syndrome 1 Autosomal dominant nonsyndromic hearing loss 6 Wolfram-like syndrome
Affected status: unknown
Allele origin:
unknown
|
Fulgent Genetics, Fulgent Genetics
Accession: SCV002816225.1
First in ClinVar: Dec 31, 2022 Last updated: Dec 31, 2022 |
|
|
|
Pathogenic
(Aug 15, 2023)
|
criteria provided, single submitter
Method: clinical testing
|
Wolfram syndrome 1
(Autosomal recessive inheritance)
Affected status: yes
Allele origin:
unknown
|
Department Of Endocrinology, Sanjay Gandhi Postgraduate Institute Of Medical Sciences
Accession: SCV004025923.1
First in ClinVar: Aug 26, 2023 Last updated: Aug 26, 2023 |
Comment:
Homozygous 15 base pair deletion in exon 8 of the WFS1 gene (chr4:g.6301320_6301334del) that results in the in-frame deletion of 5 amino acids. The observed … (more)
Homozygous 15 base pair deletion in exon 8 of the WFS1 gene (chr4:g.6301320_6301334del) that results in the in-frame deletion of 5 amino acids. The observed variation has previously been reported in patients affected with Wolfram syndrome. This variant has not been reported in the 1000 genomes and gnomAD databases. The reference region is conserved across species. PS1, PM1, PM2, PM4, PP3. (less)
Observation 1:
Clinical Features:
Diabetes mellitus (present) , Optic atrophy (absent) , Diabetes insipidus (absent) , Abnormal renal morphology (absent) , Sensorineural hearing loss disorder (absent)
Age: 0-9 years
Sex: female
Ethnicity/Population group: Indian
Geographic origin: India
Comment on evidence:
Proband presented with young onset, insulin requiring diabetes mellitus and was suspected to have type 1 diabetes mellitus. Underwent genetic testing since islet antibodies were … (more)
Proband presented with young onset, insulin requiring diabetes mellitus and was suspected to have type 1 diabetes mellitus. Underwent genetic testing since islet antibodies were negative. (less)
Method: DNA was used to perform targeted gene capture using a custom capture kit. The libraries were sequenced to mean >80- 100X coverage on Illumina sequencing platform. We follow the GATK best practices framework for identification of variants in the sample using Sentieon (v201808.07). The sequences obtained are aligned to human reference genome (GRCh38.p13) using Sentieon aligner and analyzed using Sentieon for removing duplicates, recalibration and re- alignment of indels. Sentieon haplotype caller has been used to identify variants which are relevant to the clinical indication. Gene annotation of the variants is performed using VEP program against the Ensembl release 99 human gene model
Testing laboratory: Medgenome labs private limited
Date variant was reported to submitter: 2022-07-27
Testing laboratory interpretation: Likely pathogenic
Observation 2:
Clinical Features:
Diabetes mellitus (present) , Sensorineural hearing loss disorder (absent) , Optic atrophy (absent) , Optic atrophy (absent) , Abnormal renal morphology (absent)
Age: 0-9 years
Sex: male
Ethnicity/Population group: Indian
Geographic origin: India
Comment on evidence:
Proband presented with young onset, insulin requiring diabetes mellitus and was suspected to have type 1 diabetes mellitus. Genetic testing done since all islet antibodies … (more)
Proband presented with young onset, insulin requiring diabetes mellitus and was suspected to have type 1 diabetes mellitus. Genetic testing done since all islet antibodies were negative. (less)
Method: DNA was used to perform targeted gene capture using a custom capture kit. The libraries were sequenced to mean depth of >80-100X on Illumina sequencing platform. We follow the GATK best practices framework for identification of germline variants in the sample using Sentieon [Sentieon]. The sequences obtained are aligned to human reference genome (GRCh38) using BWA aligner [Sentieon, PMID:20080505] and analyzed using Sentieon for removing duplicates, recalibration and re- alignment of indels [Sentieon]. Sentieon haplotype caller is then used to identify variants in the sample. The germline variants identified in the sample is deeply annotated using VariMAT pipeline. Gene annotation of the variants is performed using VEP program [PMID: 20562413] against the Ensembl release 99 human gene model.
Testing laboratory: Medgenome Labs Pvt Ltd
Date variant was reported to submitter: 2023-02-07
Testing laboratory interpretation: Likely pathogenic
|
|
|
Likely pathogenic
(-)
|
criteria provided, single submitter
Method: clinical testing
|
WFS1-Related Disorders
Affected status: yes
Allele origin:
germline
|
Rady Children's Institute for Genomic Medicine, Rady Children's Hospital San Diego
Accession: SCV004046024.1
First in ClinVar: Oct 21, 2023 Last updated: Oct 21, 2023 |
Comment:
This variant is also referred to as 1685del(CCTGCTCTATGTCTA) or 1683-1697del15 in the literature. This 15 base pair in-frame deletion is found in exon 8 of … (more)
This variant is also referred to as 1685del(CCTGCTCTATGTCTA) or 1683-1697del15 in the literature. This 15 base pair in-frame deletion is found in exon 8 of 8, and it leads to the loss of five amino acid residues. This variant has been previously reported as a homozygous (PMID: 23373429, 9771706, Gupta et al. 2018) and heterozygous change (PMID: 25895475) in individuals with WFS1-related disorders. The c.1525_1539del (p.Val509_Tyr513del) variant is present in the heterozygous state in the gnomAD population database at a frequency of 0.004% (10/249648) and thus is presumed to be rare. Based on the available evidence, the c.1525_1539del (p.Val509_Tyr513del) variant is classified as Likely Pathogenic. (less)
|
|
|
Pathogenic
(Jan 11, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
not provided
Affected status: unknown
Allele origin:
germline
|
Labcorp Genetics (formerly Invitae), Labcorp
Accession: SCV002233027.3
First in ClinVar: Mar 28, 2022 Last updated: Feb 14, 2024 |
Comment:
This variant, c.1525_1539del, results in the deletion of 5 amino acid(s) of the WFS1 protein (p.Val509_Tyr513del), but otherwise preserves the integrity of the reading frame. … (more)
This variant, c.1525_1539del, results in the deletion of 5 amino acid(s) of the WFS1 protein (p.Val509_Tyr513del), but otherwise preserves the integrity of the reading frame. This variant is present in population databases (rs781262017, gnomAD 0.01%). This variant has been observed in individual(s) with autosomal recessive Wolfram syndrome (PMID: 9771706, 25895475, 28432734). It has also been observed to segregate with disease in related individuals. This variant is also known as 1685del(CCTGCTCTATGTCTA) and del508YVYLL. ClinVar contains an entry for this variant (Variation ID: 1453842). For these reasons, this variant has been classified as Pathogenic. (less)
|
|
|
Likely pathogenic
(Sep 11, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Not Provided
Affected status: yes
Allele origin:
germline
|
GeneDx
Accession: SCV002559613.3
First in ClinVar: Aug 15, 2022 Last updated: Sep 29, 2024 |
Comment:
In-frame deletion of 5 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with … (more)
In-frame deletion of 5 amino acids in a non-repeat region; In silico analysis supports a deleterious effect on protein structure/function; This variant is associated with the following publications: (PMID: 23373429, 36098976, 9771706, 30352948, 33980734, 35452662, 35602877, 25895475, GosaliaH2023[Article], 28432734) (less)
|
|
|
Pathogenic
(Sep 22, 2024)
|
criteria provided, single submitter
Method: clinical testing
|
Wolfram syndrome 1
Affected status: unknown
Allele origin:
germline
|
Center for Genomic Medicine, King Faisal Specialist Hospital and Research Center
Accession: SCV005374459.1
First in ClinVar: Oct 13, 2024 Last updated: Oct 13, 2024 |
|
|
|
Pathogenic
(Oct 01, 1998)
|
no assertion criteria provided
Method: literature only
|
WOLFRAM SYNDROME 1
Affected status: not provided
Allele origin:
germline
|
OMIM
Accession: SCV000024942.3
First in ClinVar: Apr 04, 2013 Last updated: Mar 10, 2024 |
Comment on evidence:
In a consanguineous Japanese family segregating Wolfram syndrome (WFS1; 222300), Inoue et al. (1998) demonstrated that 4 affected sibs were homozygous for a 15-bp deletion … (more)
In a consanguineous Japanese family segregating Wolfram syndrome (WFS1; 222300), Inoue et al. (1998) demonstrated that 4 affected sibs were homozygous for a 15-bp deletion in the WFS1 gene resulting in deletion of 5 amino acids, tyr-val-tyr-leu-leu, beginning with residue 508. (less)
|
Germline Functional Evidence
| There is no functional evidence in ClinVar for this variation. If you have generated functional data for this variation, please consider submitting that data to ClinVar. |
Citations for germline classification of this variant
Help| Title | Author | Journal | Year | Link |
|---|---|---|---|---|
| Two Cases of Wolfram Syndrome Who Were Initially Diagnosed With Type 1 Diabetes. | Silvestri F | AACE clinical case reports | 2022 | PMID: 35602877 |
| Diabetes Mellitus Due to Wolfram Syndrome Type 1 (DIDMOAD). | Aggarwal B | Indian pediatrics | 2021 | PMID: 33980734 |
| Wolfram syndrome: clinical and genetic profiling of a cohort from a tertiary care centre with characterization of the primary gonadal failure. | Das L | Endocrine | 2020 | PMID: 32350710 |
| Monogenic diabetes syndromes: Locus-specific databases for Alström, Wolfram, and Thiamine-responsive megaloblastic anemia. | Astuti D | Human mutation | 2017 | PMID: 28432734 |
| Identification of unsuspected Wolfram syndrome cases through clinical assessment and WFS1 gene screening in type 1 diabetes mellitus patients. | Blanco-Aguirre ME | Gene | 2015 | PMID: 25895475 |
| Expansion of the clinical ocular spectrum of Wolfram Syndrome in a family carrying a novel WFS1 gene deletion. | Chacón-Camacho O | Ophthalmic genetics | 2013 | PMID: 23373429 |
| A gene encoding a transmembrane protein is mutated in patients with diabetes mellitus and optic atrophy (Wolfram syndrome). | Inoue H | Nature genetics | 1998 | PMID: 9771706 |
Text-mined citations for rs781262017 ...
HelpRecord last updated Oct 20, 2024
This date represents the last time this VCV record was updated. The update may be due to an update to one of the included submitted records (SCVs), or due to an update that ClinVar made to the variant such as adding HGVS expressions or a rs number. So this date may be different from the date of the “most recent submission” reported at the top of this page.